ID: 1136105008

View in Genome Browser
Species Human (GRCh38)
Location 16:28024176-28024198
Sequence GTTGCCCTCAGCCCCATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136105008_1136105009 -9 Left 1136105008 16:28024176-28024198 CCTTCAATGGGGCTGAGGGCAAC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1136105009 16:28024190-28024212 GAGGGCAACTCGATGCCCCCAGG 0: 1
1: 0
2: 1
3: 2
4: 59
1136105008_1136105016 16 Left 1136105008 16:28024176-28024198 CCTTCAATGGGGCTGAGGGCAAC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1136105016 16:28024215-28024237 TCACAACCAGGTGAGACACATGG 0: 1
1: 0
2: 1
3: 12
4: 180
1136105008_1136105018 29 Left 1136105008 16:28024176-28024198 CCTTCAATGGGGCTGAGGGCAAC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1136105018 16:28024228-28024250 AGACACATGGAGCCCAGCTCTGG 0: 1
1: 0
2: 4
3: 24
4: 220
1136105008_1136105011 4 Left 1136105008 16:28024176-28024198 CCTTCAATGGGGCTGAGGGCAAC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1136105011 16:28024203-28024225 TGCCCCCAGGGTTCACAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 155
1136105008_1136105010 -8 Left 1136105008 16:28024176-28024198 CCTTCAATGGGGCTGAGGGCAAC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1136105010 16:28024191-28024213 AGGGCAACTCGATGCCCCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 80
1136105008_1136105019 30 Left 1136105008 16:28024176-28024198 CCTTCAATGGGGCTGAGGGCAAC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1136105019 16:28024229-28024251 GACACATGGAGCCCAGCTCTGGG 0: 1
1: 0
2: 1
3: 24
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136105008 Original CRISPR GTTGCCCTCAGCCCCATTGA AGG (reversed) Intronic
900913322 1:5617457-5617479 GATGGCCTCAGCCCCATTCCTGG - Intergenic
901292830 1:8137530-8137552 ATTTCCCTCATCCCCTTTGAGGG - Intergenic
901785050 1:11619081-11619103 ATTGCCCTCAGCCCCTGTGACGG + Intergenic
905401459 1:37706695-37706717 GCTGACCTCAGCCCCTGTGAGGG + Intronic
907647155 1:56255600-56255622 TTTGCCCCCATCCTCATTGATGG + Intergenic
907755471 1:57306288-57306310 GTAGCCCTCAGGCTCATTGAAGG - Intronic
908300204 1:62755431-62755453 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
908490430 1:64638125-64638147 GTTGACCTCAGGCCCAAAGATGG + Intronic
911370811 1:96992839-96992861 GTTCCCCTCATCCCTACTGAGGG - Intergenic
911751204 1:101500038-101500060 TTTGCCCAAAGCCCCATTGGAGG + Intergenic
915611668 1:156998455-156998477 TTTGCTCTCAGTCCCATAGATGG - Intronic
920939615 1:210469373-210469395 GTTAGCCCCAGCCACATTGAAGG + Intronic
921542175 1:216429825-216429847 CTTGCCCTCTGGACCATTGAGGG + Intergenic
1063026550 10:2184506-2184528 GTTGTCCTCTGCCTCCTTGAGGG - Intergenic
1063859292 10:10290556-10290578 TTTGCCCAAAGCCCCATTGAGGG - Intergenic
1064603767 10:17017675-17017697 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1066614777 10:37283457-37283479 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1068860798 10:61845973-61845995 GTTTCCCTCAGACTCATGGATGG - Intergenic
1070275206 10:74999404-74999426 GTTGCCCTCACCCACATCCATGG - Intronic
1073501127 10:103938104-103938126 GTTGCCCTCTGCCTCATTGCAGG + Intergenic
1075942059 10:126398305-126398327 GTTGCCCTCAACCCCATGCTGGG + Intergenic
1076008449 10:126967246-126967268 GTTGCCCTCAACCCCTAAGAAGG + Intronic
1077404707 11:2377787-2377809 GCAGCCCTCAGCCCCAATGTCGG - Intronic
1077508151 11:2941597-2941619 GCTGCCCCCAGCCCCATCGCTGG - Intergenic
1081626158 11:44656383-44656405 GTTCCCCTCAGCCCCCTTTTTGG - Intergenic
1081793144 11:45803168-45803190 GCTGCGCTCAGCTCCAGTGAAGG + Intergenic
1089173963 11:116535224-116535246 GTGGCCCTCAGCACCATAGCTGG - Intergenic
1093289984 12:17308279-17308301 GTTGCCTTCACCCCCACTGAGGG - Intergenic
1095198687 12:39356297-39356319 CTTGCCCCCAGCCCCAGTCATGG + Intronic
1097369486 12:58759098-58759120 GTGGCCCTCAGCTCCATCCATGG + Intronic
1097428126 12:59472104-59472126 TTTGCCCAAAGCCCCATTGGAGG + Intergenic
1097606017 12:61755390-61755412 GCTGGCCTCAGTCCCATTGCAGG - Intronic
1097679783 12:62637872-62637894 CTTGCTCACAGCCCCTTTGAGGG - Intergenic
1097685086 12:62683764-62683786 GTTGCCTTTAGCCCCATTTTGGG - Intronic
1099414940 12:82373375-82373397 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1100091972 12:90983881-90983903 TTTGCCCAAAGCCCCATTGGAGG + Intronic
1102057178 12:109905401-109905423 GCTGCCCCCAGCCCCTTTGGAGG - Intronic
1102192382 12:110998518-110998540 GTGGGCCTCAGCCCCATGGCCGG + Intergenic
1104103534 12:125637645-125637667 GTTGCTTTCAGCCACAATGATGG - Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1105400558 13:20090708-20090730 GTTGCCCCAGGCCCCATTGAGGG - Exonic
1106019798 13:25903691-25903713 TTTGCCCTCAGCCCTCTCGAGGG + Intronic
1106475745 13:30096663-30096685 GTTCCTCCCTGCCCCATTGATGG + Intergenic
1122412572 14:101533487-101533509 GTTTCCCTCAGCTGCTTTGATGG - Intergenic
1122994016 14:105252979-105253001 CTTGGCCTCAGCCCCCTTGCTGG + Intronic
1123936835 15:25198169-25198191 GGTCCCCTCAGTCCCATTGAAGG + Intergenic
1124810193 15:32929147-32929169 GCTGCCCCCAGCCCCTTTGTAGG - Intronic
1129042698 15:72703628-72703650 CTTGCCCTAGGCCCCATAGAAGG + Intronic
1132537694 16:491323-491345 GATACCCACAGCCCCCTTGAGGG + Intronic
1133039899 16:3055108-3055130 GCTCCCCTCAGCCCCATTCCAGG - Intronic
1133906874 16:10030444-10030466 CTTGCCCTCATCCCCATAGCAGG - Intronic
1134112612 16:11524613-11524635 GTTGTCCTCTGCCCCTTCGATGG - Intergenic
1135181509 16:20278555-20278577 GTTTCCCTCAGCCTCTTTGGGGG + Intergenic
1135874736 16:26187881-26187903 TTTGACCTCAGCACCATTGATGG + Intergenic
1136105008 16:28024176-28024198 GTTGCCCTCAGCCCCATTGAAGG - Intronic
1138075175 16:54035338-54035360 GTTGCCCTCAACCAAACTGAGGG - Intronic
1138383565 16:56620371-56620393 ATTGCCCTCAGCCCAGCTGATGG - Intergenic
1138421118 16:56899789-56899811 GGTCCCCTCAGCCCCAGGGAGGG - Intronic
1142850437 17:2701957-2701979 GTTGCAGTCAACCCCGTTGAAGG + Exonic
1143451810 17:7041291-7041313 ATTTCCCTCAGGCCCATAGAAGG + Intergenic
1143563227 17:7707370-7707392 GTTCCCATCAGCCCCAATGATGG + Intronic
1144679620 17:17184300-17184322 GCTGCCCTCAGACCCATTTCTGG - Intronic
1149209458 17:54287247-54287269 TTTGCCCAAAGCCCCATTGTCGG + Intergenic
1151419296 17:73986862-73986884 GGTGCCATCAGCCCCATTTCTGG - Intergenic
1153762776 18:8347878-8347900 ATTGCCATCAGCCCCTTGGATGG + Intronic
1160805586 19:991023-991045 GATGCCCTCAGCCCCAGGGCAGG - Intronic
1163296944 19:16418543-16418565 GCTGCTGTCATCCCCATTGAAGG - Intronic
1166077674 19:40423167-40423189 GAGGACCTCAGCCACATTGAGGG - Exonic
1166769597 19:45273295-45273317 GCTGCCCTCATCGGCATTGATGG + Intronic
1168074585 19:53972928-53972950 GTTGCCCAAAGCCCTATTGGGGG - Intronic
929662271 2:43798848-43798870 CTTACCCTCTGCCCCATTTAAGG + Intronic
932344335 2:70985703-70985725 GTTGCCCTCCACCCCATTCTGGG - Intronic
933644599 2:84799984-84800006 GTTGCCTCCACCCCCACTGAGGG + Intronic
937765346 2:125654507-125654529 GTTGCCCTCAACCCACTGGAGGG - Intergenic
937875187 2:126819781-126819803 CTTGAGCTCAGCTCCATTGAAGG - Intergenic
938694889 2:133826215-133826237 GTTGCCATTTGCCCCAGTGAGGG + Intergenic
938806396 2:134810328-134810350 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
940115854 2:150207276-150207298 GTTGCACTTAGCCCCATTTGGGG + Intergenic
942311769 2:174663139-174663161 GTGGCCCTGATCCCCATAGATGG - Intronic
948800489 2:240431159-240431181 GCTGCCCTCAGCCACAGTGCAGG - Intergenic
948806337 2:240454888-240454910 GTGGCCCCCATCCCCAATGATGG - Intronic
1169756984 20:9053104-9053126 TTTGTCCTCAGCCCCATTTCTGG + Intergenic
1170705832 20:18744206-18744228 GTCGCCCTCAGCCCCGCTGCTGG - Exonic
1170756622 20:19211839-19211861 GTTTCCCTCTGCCCCCTTGCGGG - Intergenic
1174429205 20:50455877-50455899 GGGGCCCTCAGCCCCAGTAAGGG + Intergenic
1176098762 20:63355739-63355761 GATGCCCTCAGCCTCTTTGCTGG + Intronic
1181637227 22:24180144-24180166 GGTGCCCTGAGCGCCATTGTGGG + Intergenic
1182339185 22:29605646-29605668 TTTGCCCTCAGGACCATTGCCGG - Intronic
1183190394 22:36318693-36318715 GCTCCTCTCAGCCCCATTGGTGG - Intronic
1183304464 22:37075049-37075071 GCTGCCCACAGCCCCCTTGGTGG + Intronic
950078786 3:10206423-10206445 GCTGCCCTCAGCCTCATTCCTGG - Intronic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
950867353 3:16199765-16199787 GCTGCCCCCAGCCCCAGTCATGG - Intronic
952742464 3:36747995-36748017 GATCCCCTCACCCCCACTGAGGG - Intergenic
970519214 4:16865342-16865364 ACTGCCCTCAGCCCTATTGCAGG + Intronic
975047785 4:69826002-69826024 TTTGCCCAAAGCCCCATTGTAGG + Intronic
978368225 4:108004671-108004693 GTTGGCCTCAGCAGCAATGAGGG + Intronic
982060410 4:151598966-151598988 GCTGCCCCCAGCCCCACTGGGGG + Intronic
985102015 4:186467655-186467677 GTTGCCCTGAACCCCATCAAAGG + Intronic
986254160 5:6087908-6087930 GCTACCCTCTGCCCCAGTGAGGG - Intergenic
987545470 5:19306301-19306323 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
988428951 5:31096539-31096561 GTTTCCCTCTGCCACAGTGATGG - Intergenic
994711893 5:103275969-103275991 GTTGGCCTCAGCCCCAGGGAAGG - Exonic
995583656 5:113624799-113624821 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
995940229 5:117572846-117572868 GTTGTCATCATCCCCATTAAGGG + Intergenic
997461204 5:134053619-134053641 GTCCCCCTCAGCCCCATTCCGGG + Intergenic
997741521 5:136258978-136259000 GTTGGCCTCAGACACATTCAGGG + Intronic
998111233 5:139504385-139504407 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
998600756 5:143582344-143582366 GTTTCCCTCAGCCCCCCTGATGG - Intergenic
1001761874 5:174214255-174214277 TTTCCCCTCAGCTCCATGGAAGG - Intronic
1002298883 5:178246652-178246674 GGCTCCCTCAGCCCCATGGAAGG + Intronic
1004308780 6:14525163-14525185 GTTGTCCTCAGGGCCATAGATGG + Intergenic
1004553600 6:16673804-16673826 AATGCCCCCAGCCCCATTGCAGG + Intronic
1005033900 6:21537659-21537681 TTTGCCCTCAACCCCATTGTTGG + Intergenic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1007902945 6:45428551-45428573 CTTGCTCTCAGCCTCATAGAAGG + Intronic
1009625541 6:66135895-66135917 GTGGCTCTCAAGCCCATTGATGG + Intergenic
1012441766 6:99267550-99267572 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1016026066 6:139288300-139288322 GTTCACCTGAGCTCCATTGAGGG + Intronic
1016236205 6:141870027-141870049 GGTGACTTCAGCCCCATTTAAGG - Intergenic
1018963432 6:168465070-168465092 GTTGGCCCCTGCCCCATGGAAGG + Intronic
1019552589 7:1610576-1610598 GTGGGCCTCAGCCCTATGGAGGG - Intergenic
1023151280 7:37203516-37203538 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1023359717 7:39403114-39403136 GATGCCCTCAGCTGCATTAATGG + Intronic
1024494155 7:50023878-50023900 CTTTCCCCCAGCCCCACTGATGG - Intronic
1024735054 7:52295977-52295999 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
1028495460 7:91455327-91455349 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1029699349 7:102236270-102236292 GGTGGCCTCTGCCCCATTCAGGG + Intronic
1030286013 7:107827474-107827496 GGTGCCCTCAGGCCCAGTGAAGG - Intergenic
1032100024 7:128967601-128967623 GATGCCCGCTGCCCCTTTGAAGG - Intronic
1032624122 7:133571206-133571228 GTTGCAATAAGCCCCTTTGATGG + Intronic
1034982916 7:155490006-155490028 GTTGCCCTCATGCCCAGTGCAGG - Intronic
1040965305 8:53076013-53076035 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1042114372 8:65414890-65414912 GTTGCCAACAGCCCCCTTGCAGG - Intergenic
1046620927 8:116528734-116528756 TTTTCCCACAGCCCCATTGCTGG - Intergenic
1046857604 8:119051351-119051373 TTTGCCCTCAGCCAGATTGTTGG - Intronic
1049418299 8:142505483-142505505 GTCGCCCTCAGCCCCAGTGCAGG - Intronic
1049762902 8:144338914-144338936 TTTGCCCCCAGTCCCCTTGACGG + Intergenic
1051935023 9:22435622-22435644 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
1052880638 9:33599274-33599296 GCTTCCCTCAGGCCCATTTAGGG + Intergenic
1053495335 9:38544937-38544959 GCTTCCCTCAGGCCCATTTAGGG - Intronic
1055985895 9:82056375-82056397 GCTTCCCTCAGGCCCATTTAGGG + Intergenic
1056585445 9:87924755-87924777 GCTTCCCTCAGGCCCATTTAGGG - Intergenic
1057675232 9:97132294-97132316 GCTTCCCTCAGGCCCATTTAGGG - Intergenic
1057818271 9:98311683-98311705 CTTGCCCACAGCCCCACTGCTGG + Intronic
1061801418 9:133115246-133115268 GTGGCCCCCTGCCCCATGGATGG + Intronic
1062263738 9:135677080-135677102 GTTGCCGTCAGCCCGAACGAGGG - Intergenic
1188136252 X:26498464-26498486 GTTGCCCAAAGCCCCACTGGTGG + Intergenic
1195461355 X:105129240-105129262 CTTGCTCTCAGCCTCATAGAGGG + Intronic
1195753339 X:108178328-108178350 GCTGCCCACAGCACCAGTGAAGG + Intronic
1195968057 X:110447334-110447356 GAAGCCCTCAGCCCCATTCTTGG + Intronic
1200094144 X:153649441-153649463 GATGCCCGCAGCCCCACTGGTGG - Exonic
1200881019 Y:8211217-8211239 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1201403545 Y:13628915-13628937 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
1201568799 Y:15392657-15392679 TTTGCCCAGAGCCCCATTGTAGG - Intergenic
1202242647 Y:22787236-22787258 TTTGCCCAAAGCCCCATTGCAGG + Intergenic
1202395634 Y:24420986-24421008 TTTGCCCAAAGCCCCATTGCAGG + Intergenic
1202475151 Y:25249106-25249128 TTTGCCCAAAGCCCCATTGCAGG - Intergenic