ID: 1136105489

View in Genome Browser
Species Human (GRCh38)
Location 16:28027079-28027101
Sequence GGACACACAGCAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 6, 3: 144, 4: 413}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136105480_1136105489 16 Left 1136105480 16:28027040-28027062 CCACTGCACTCAGAAGTGGGACA 0: 1
1: 0
2: 0
3: 15
4: 296
Right 1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG 0: 1
1: 0
2: 6
3: 144
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136105489 Original CRISPR GGACACACAGCAGTGGTGGA GGG Intronic
900678509 1:3903319-3903341 GGACAGACAACATTGGTGAAGGG - Intergenic
900840629 1:5046050-5046072 AGACACAGAGAAGGGGTGGAGGG - Intergenic
900841893 1:5056676-5056698 GGAAACTCAGAAGTGGGGGAGGG + Intergenic
902746803 1:18480126-18480148 GGACCCACAGCACTGGTGATGGG + Intergenic
902835911 1:19046720-19046742 GGACAGACCCCAGTGCTGGATGG + Intergenic
903325824 1:22567978-22568000 GGACACACAGCAGTTAGAGACGG + Intronic
903378613 1:22881979-22882001 GCACTCACAGCACTGGTGGGAGG + Intronic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
905233245 1:36528800-36528822 GGACACACAGCAGGAAGGGATGG - Intergenic
905426359 1:37888183-37888205 GCACACAGAGCTGTGGTTGAAGG - Intronic
907150782 1:52285390-52285412 GGCCACACAGCAGAGGTGAGGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907888946 1:58619885-58619907 GGACACACTCCAGTGCTGGGTGG + Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
908982435 1:69975426-69975448 GGACAGACAGAAGTGGAAGAAGG - Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912391778 1:109307838-109307860 GGAGAGGCAGCAGTGGTGGAGGG + Intergenic
912706550 1:111919323-111919345 GGGCACACAGCTGAGGTGGGTGG + Intronic
913507017 1:119526486-119526508 GGAGACAGAGCACTGGGGGATGG - Intergenic
915166565 1:153951371-153951393 GGGCACACGGCGGTGGTGGGGGG + Exonic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917196090 1:172467210-172467232 GGGAACACAGCACAGGTGGAAGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917743198 1:177981831-177981853 AGACACACACCTGTGGTGGGTGG + Intronic
918536910 1:185584894-185584916 AGCCACACAGCGGTGGGGGAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919468812 1:197953708-197953730 GAACACTCAGCAGTGATGAATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920309183 1:205038554-205038576 GGTCACAGAGCAGTGGAGGTGGG - Intergenic
920336686 1:205249675-205249697 TCACACCCAGGAGTGGTGGAGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921880650 1:220250863-220250885 GGAAACACAGTGGTGGAGGAAGG - Intronic
922186248 1:223277450-223277472 GGACAAAAAGCACAGGTGGAAGG + Intronic
922237520 1:223733250-223733272 GGAAAGACAGCAGTAGCGGAAGG + Intronic
922678223 1:227566324-227566346 GGAGACACATCAGTGGTGTTGGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924069528 1:240262020-240262042 GGACAAACAGCACTGGCTGAAGG - Intronic
924596172 1:245446870-245446892 GGACCCACAGCAATGCTGGTGGG - Intronic
1062883283 10:995822-995844 GGAGACACTGCAGGCGTGGAGGG + Intronic
1062948772 10:1479967-1479989 TGACACACAGAAGAGATGGAAGG + Intronic
1062955771 10:1539401-1539423 AGGCACACAGCACTGGTCGATGG - Intronic
1063129835 10:3168708-3168730 GGAAACACAATCGTGGTGGAAGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065786661 10:29222116-29222138 GGACACACAGGATTGGTGGGTGG + Intergenic
1065868311 10:29933554-29933576 GGCCTCACAGTTGTGGTGGAAGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066302599 10:34110042-34110064 GGTCCCACAGCGGTGGTGGCAGG - Exonic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069827964 10:71265826-71265848 GGACAGCCAGCAGTGGGGGTGGG - Intronic
1069967775 10:72135684-72135706 GGACAGACAGCAGTGGAGGCAGG + Intronic
1070583391 10:77742037-77742059 GGCCACTCAGCAGTGGTGGTAGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077292421 11:1804114-1804136 GGACAGACGGCAGGTGTGGAGGG + Intergenic
1077361602 11:2143217-2143239 TGACACTCAGCAGGGCTGGAAGG - Intronic
1078267596 11:9766548-9766570 GGCCACACAGCAGTGCCTGATGG - Intergenic
1078430371 11:11283517-11283539 GGGCACAGAGCATTGGAGGAAGG + Intronic
1078524325 11:12089133-12089155 GGACAGAAAGCAGTGCTGCAAGG - Intergenic
1079574329 11:21984691-21984713 TGACACACAGCAGTGGTGTCTGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080128984 11:28770759-28770781 GGACACACTGGAGTGGAGGTTGG - Intergenic
1080431094 11:32200646-32200668 GGACACACAGTGGTGGCTGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081632700 11:44700656-44700678 ACACACACAGCAGAGATGGAAGG - Intergenic
1082884736 11:58069956-58069978 GGACACACAGCTCTGCTGCAAGG - Intronic
1083986084 11:66216406-66216428 GGAAACACAGCCAGGGTGGAGGG - Intronic
1083988085 11:66230047-66230069 GGACACACAGCAGTGGCTTGGGG + Intronic
1084442652 11:69183798-69183820 GGCCACAGAGCAGTGCTGGAGGG + Intergenic
1084596775 11:70121194-70121216 GGACAGAGAGAAGTGGGGGAGGG - Intronic
1084670682 11:70604915-70604937 GGACACAGGGCAGTGGTGTGTGG + Intronic
1084731501 11:71076569-71076591 GGAGACACAGCAATGGTAAATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084935596 11:72584932-72584954 GAACACAGAGCAGCTGTGGAGGG + Exonic
1085265594 11:75236241-75236263 TGTCTCACAGCAGTGGGGGAGGG + Intergenic
1085526083 11:77165147-77165169 GGACACACAGGAATGGAGGGTGG - Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089279860 11:117366264-117366286 GGACACTCAGGAGTGGGGAAAGG - Intronic
1089563758 11:119359536-119359558 GCACACACAGCCCTCGTGGAAGG - Exonic
1090404387 11:126468182-126468204 GTCCACACAGCAGGGGAGGAAGG - Intronic
1090885533 11:130872895-130872917 GGACAAACAGCCGGTGTGGAGGG + Intergenic
1092655263 12:10677393-10677415 GGACACACAGCAATGACAGAAGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093355718 12:18164386-18164408 GGCCTCACAACTGTGGTGGAAGG + Intronic
1094284021 12:28772320-28772342 GGTCACACAGAAATGGTGGGGGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095039150 12:37423071-37423093 AGACATACAGCAGTGGCAGAGGG + Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097169050 12:57102308-57102330 GGACACAGAACGGTGCTGGAAGG + Exonic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098848655 12:75568400-75568422 AGACATTCAGCTGTGGTGGAAGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1102225145 12:111223402-111223424 GGACACACGGCAGATGTGCATGG - Intronic
1102914943 12:116745617-116745639 TGACACACAGCAGTGGGACACGG - Intronic
1103779126 12:123388041-123388063 GGCCACAGAGTAGTGGTGCAGGG + Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103948571 12:124540200-124540222 GGCGACCCAGCAGTGGTGGGAGG + Intronic
1104330043 12:127836198-127836220 GAACACACAGCGCTGGTAGAGGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105344548 13:19560977-19560999 TGACACACCGCAGTGGTAGCCGG + Intergenic
1106143226 13:27028498-27028520 GGACACAAGGCAGGTGTGGAAGG - Intergenic
1106235635 13:27858091-27858113 GTACACACAGCCGGGGTGGATGG - Intergenic
1106240570 13:27909260-27909282 GGAAACACAGCAGGGGAAGAGGG + Intergenic
1107012257 13:35680753-35680775 GGACACACAGCAGCTGGGGCGGG - Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108431746 13:50360397-50360419 GGTCACACGGCAGTGGTGGCAGG - Intronic
1108494077 13:51007247-51007269 GGACACACAACAGCAGGGGAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109744338 13:66602397-66602419 GGACAAAATGCAGAGGTGGAAGG + Intronic
1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947782 13:94683480-94683502 GGAGACACAGTAGAGGTTGAGGG + Intergenic
1112541148 13:100314318-100314340 GAACACACGGAAGTGATGGAGGG - Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114398755 14:22390081-22390103 GGGCACACAGCAGAAGGGGAGGG + Intergenic
1114517283 14:23308177-23308199 GGATCCACAGCAGTGGGGGCTGG + Exonic
1114562309 14:23602240-23602262 GGAGACACAGTAGTGGTTGAAGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117800863 14:59443316-59443338 GAACCCACAGCAGGGATGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119703553 14:76770640-76770662 GGACACACAGCTCTGGGGCAGGG - Intronic
1119740861 14:77012925-77012947 GGACTCTCAGCACTGGGGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120557298 14:85944654-85944676 GGACTCACAGTCATGGTGGAAGG + Intergenic
1121332848 14:93059348-93059370 GGTCACAAGGCAGGGGTGGAGGG + Intronic
1121332920 14:93059571-93059593 GGTCACAAGGCAGGGGTGGAGGG + Intronic
1121663220 14:95651283-95651305 GCACACAGAGCAGTGGTCTAGGG + Intergenic
1122740050 14:103867075-103867097 GGACACACTGCAGGGCTGGGGGG + Intergenic
1122810804 14:104286975-104286997 TGACACACACCAGTGGGAGAAGG + Intergenic
1122891705 14:104735035-104735057 GGCCACACGGTGGTGGTGGATGG + Exonic
1123104396 14:105831571-105831593 GGAAACACAGTCGTGGTGGAAGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123628182 15:22241957-22241979 GGCCTCACAGTCGTGGTGGAAGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124799758 15:32820575-32820597 GGACACTCAGAAGTTCTGGAAGG - Intronic
1125679910 15:41524059-41524081 GGACCCACAGGACAGGTGGAGGG - Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128962044 15:72016354-72016376 GCACAAACAGCAGTGTTGCATGG - Intronic
1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG + Intergenic
1129686503 15:77689163-77689185 GGAGAAGCAGCAGAGGTGGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130822161 15:87507256-87507278 GGCCTCACAGTAGTGGTGGAAGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132747374 16:1442661-1442683 GGAAACACAGCACCGGTGGCAGG + Intronic
1133245382 16:4445335-4445357 GTACAGACAGCAGGGATGGAAGG + Intronic
1133542442 16:6769284-6769306 GGCCACACAGTCATGGTGGAAGG - Intronic
1135668713 16:24356864-24356886 GGCCTCACAACAATGGTGGAAGG + Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1137675718 16:50302914-50302936 GGCCACACAGCAATGGCGTAAGG - Intronic
1137699981 16:50490525-50490547 GGACACACAGCTCTGGAGGCTGG - Intergenic
1139558138 16:67725606-67725628 GGCCACACAGCAGAGGTAGAGGG - Exonic
1141609747 16:85174647-85174669 GGACACACATGAGGAGTGGAGGG + Intronic
1141975761 16:87515371-87515393 GGCCTCACAGTCGTGGTGGAAGG + Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142373121 16:89694000-89694022 GCACACACAGCAATGGTTGCCGG - Intronic
1143096820 17:4482771-4482793 GGACAGACAGCAGGGCTGGGAGG - Intronic
1143473834 17:7192051-7192073 GGACAGAGAGCAGTGCCGGAGGG + Intronic
1143894580 17:10126068-10126090 GGACCCACAGCAGGGGTCGGGGG + Intronic
1144203632 17:12963556-12963578 GCACACACAGCATTGATGCAAGG - Intronic
1144203636 17:12963590-12963612 GCACACACAGCATTGGTGCAAGG - Intronic
1144203649 17:12963692-12963714 GCACACACGGCACTGGTGCATGG - Intronic
1145007916 17:19347915-19347937 GGACACACAGGGGAGGTGCAGGG + Intronic
1146747388 17:35344474-35344496 GGACATGCAACAGTTGTGGAAGG - Intergenic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150226490 17:63527356-63527378 GGACTCACCACAGTGCTGGATGG + Intronic
1150774244 17:68066359-68066381 GGACACTCAGCTGTGGTGCGAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151266044 17:72955910-72955932 GGATAGACGGCAGGGGTGGATGG - Intronic
1151632310 17:75319181-75319203 GGAGACAAAGCAGGAGTGGAAGG - Exonic
1151759227 17:76091093-76091115 GGACACACAGTGGAGGAGGAAGG + Intronic
1152533279 17:80934009-80934031 GGACATAAAGTAGTGATGGAAGG - Intronic
1152615517 17:81336129-81336151 GGACAGACAGGGGTGGAGGAGGG - Intergenic
1203162158 17_GL000205v2_random:62784-62806 GGACCCAGAGCAGGGGTTGAAGG + Intergenic
1153070094 18:1095692-1095714 GGAGACAGAGCAGGGGAGGAAGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155265446 18:24088622-24088644 GGACACAACAGAGTGGTGGACGG - Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157485538 18:48084431-48084453 TGACTCACAGCAGTGGCGGCAGG + Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158223998 18:55181855-55181877 GGACACAGAGCTGTGTTGGCTGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1159999592 18:75004093-75004115 GGCCACACTGCAGTGGTAGCAGG - Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1162137942 19:8567715-8567737 GGACACACAGCAGTGCAGAGAGG + Intronic
1162627176 19:11894033-11894055 GGACACAATGCAGTGTTGGTGGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165092748 19:33395412-33395434 GTACACAGAGGAGTGGGGGATGG - Intronic
1165116099 19:33529707-33529729 GGCCACACAGCAGTGCTGCTTGG - Intergenic
1165181268 19:33973036-33973058 GGACAAACAGGAGAGGGGGAGGG - Intergenic
1165286455 19:34846726-34846748 GGACACACAACAGCAGTGGGGGG - Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1166645624 19:44529668-44529690 GGACAGACAGGGGTGGTGGCAGG + Intronic
1166819323 19:45567514-45567536 GGAGACAGAGCAGGGGAGGAGGG + Intronic
1167062546 19:47158800-47158822 GGCCACACAGCTGTGGAAGAAGG + Intronic
1167264251 19:48475534-48475556 GGAAACCCAGCAGAGATGGAGGG + Intronic
1167405222 19:49302245-49302267 GGACTCGCAGCAGTGGAGGCTGG - Intronic
1167497785 19:49829697-49829719 AGCCACACAGCAGTTGTGGTAGG + Intronic
1167513479 19:49909356-49909378 GGAGCCACAGAGGTGGTGGAGGG + Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168189822 19:54729888-54729910 GAACACACAGCATGGGTGTAAGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925019893 2:560207-560229 GGACACACCCCAGTCCTGGATGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925140021 2:1543892-1543914 GGAAACACAGTCATGGTGGAAGG + Intergenic
925176202 2:1785581-1785603 GAAAACAAAGCTGTGGTGGAAGG + Intergenic
925246740 2:2390219-2390241 GGAAACACAGTGATGGTGGAAGG + Intergenic
925670309 2:6303814-6303836 GGACAGACTGCAGTGGTTGGGGG + Intergenic
925743365 2:7024979-7025001 GGACAGACAGAAGTGGGGGCTGG + Intronic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930314850 2:49785317-49785339 ACACACACACCAGTGGTGGTGGG + Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932463150 2:71896373-71896395 GGGCACACAGTAATGATGGATGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933694471 2:85207252-85207274 GCACACAAAGCAGTGGTTGCTGG + Intronic
933864280 2:86501610-86501632 GGAAACACAGTCGTGGCGGAAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935844716 2:107153352-107153374 GGATACACAGCAGATGCGGAAGG - Intergenic
936428084 2:112436235-112436257 GAACAAACAGCAGGGGTGGGGGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937453187 2:122019174-122019196 GGAAACACAGTGGGGGTGGAGGG + Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940012929 2:149073641-149073663 GGAGACACAGCAGTGGTAGGAGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940769788 2:157827815-157827837 TGTCACACAGCAGTGGTGCGGGG - Intronic
940970616 2:159892852-159892874 AAACACACAGGAATGGTGGAAGG + Intronic
941456354 2:165715005-165715027 AGACACAGAGAAGGGGTGGAGGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943119975 2:183723710-183723732 GGGTCCACAGGAGTGGTGGATGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945284059 2:208064778-208064800 GGACACAGAGCAGGTGAGGAAGG + Intergenic
946484449 2:220087799-220087821 GGACAAACTAGAGTGGTGGAGGG + Intergenic
946773058 2:223109238-223109260 GGAAACTCAGCAGTAGTTGATGG - Intronic
947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG + Intergenic
948064758 2:235069283-235069305 GGCCTCACAGCCATGGTGGAAGG + Intergenic
948087529 2:235263983-235264005 TGTCACACAGCCCTGGTGGATGG - Intergenic
948695357 2:239730423-239730445 GGTCACACAGCAGTTGGAGAAGG - Intergenic
948695371 2:239730515-239730537 GGTCACACAGCAGTTGGAGAAGG - Intergenic
948695386 2:239730607-239730629 GGTCACACAGCAGTTGGAGAAGG - Intergenic
1168962110 20:1876995-1877017 GGACACACAGGGGTGGTGTGGGG - Intergenic
1170421740 20:16200121-16200143 GGAGACCCAGCAGTGGTGGCAGG - Intergenic
1171144859 20:22772676-22772698 GGACACACAGCAATGGAGGGCGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172487451 20:35306916-35306938 AGTCACACAGTAGAGGTGGAAGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173658241 20:44715625-44715647 GGTCACACAGCAGGGCTGGCCGG - Intronic
1174048194 20:47748569-47748591 GGACAGAGAGCAGGGCTGGAAGG - Intronic
1175008975 20:55715494-55715516 GTTCACTCAGCAGTGGTAGAGGG + Intergenic
1175975403 20:62708302-62708324 GGACACCCAGGAGTGGGGGTCGG + Intergenic
1176374169 21:6078976-6078998 GAACAAACAGCAGGGGTGGGAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177883011 21:26716427-26716449 GGACATACAAAAGTGGGGGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178704802 21:34864414-34864436 GGACCCAGTGCAGGGGTGGAAGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179327874 21:40367294-40367316 GGACCAGCAGCAGAGGTGGAAGG - Intronic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1179749308 21:43459269-43459291 GAACAAACAGCAGGGGTGGGAGG - Intergenic
1180727216 22:17955325-17955347 AGACACACACCTGTTGTGGAGGG - Intronic
1181141172 22:20806032-20806054 CAACACACAGCAGGGGTGGTGGG + Intronic
1181925575 22:26355945-26355967 GGTCACTCAGCAGAGCTGGAGGG - Intronic
1182072688 22:27474885-27474907 GGACACACAGCAGGGTGTGATGG + Intergenic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1183364959 22:37402021-37402043 GGTCACACAGCTGTGGAGGAGGG - Intronic
1183512171 22:38242707-38242729 GGACCCAGAGCAGTGGTGCAGGG + Intronic
1183602926 22:38850500-38850522 AGACACACTCCAGAGGTGGAGGG - Intergenic
1184389959 22:44197643-44197665 GGTCACACAGCAAATGTGGAGGG - Intronic
1184762261 22:46551324-46551346 GGAGAGACGGCAGTGGAGGAGGG - Intergenic
1184866594 22:47205026-47205048 GGAGAGAGAGCAGAGGTGGAGGG + Intergenic
1184872725 22:47251248-47251270 GGTCACACAGCCCTAGTGGAGGG - Intergenic
1185146159 22:49137741-49137763 GGACACACACCAATGGCCGATGG + Intergenic
1185175793 22:49325803-49325825 GGAGACACAGACGTGGTGCAGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950431604 3:12954202-12954224 GGTCTCACAGCAGCCGTGGAGGG - Intronic
950738408 3:15030343-15030365 GGATAGACACCAGTGGAGGAGGG + Exonic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951875511 3:27420243-27420265 GGACACACAGCACTGATGTTTGG + Intronic
952675613 3:36026760-36026782 AGACACGCAGGAGTGGTGCAAGG + Intergenic
952726751 3:36594679-36594701 AGACACACAGCATTGGGGAAAGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953198195 3:40753810-40753832 GGACATCCAGCAGTGAGGGAGGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954179202 3:48868235-48868257 GGTCACACAGCAGAGTAGGAGGG + Intronic
954291778 3:49653697-49653719 GGAGCCACAGCTGTGGTGGCTGG - Exonic
954572853 3:51656609-51656631 GGCCAGTCAGCAGTGGTGGCAGG + Intronic
954911515 3:54114557-54114579 GGCCAGGCAGCAGTGGTGGGGGG + Intergenic
955272912 3:57519741-57519763 GGACATGCAGCAGTTGCGGAAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956044045 3:65176266-65176288 AGAAACTCAGCAGTGGTGTATGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959370578 3:105520470-105520492 GGACAGACCTCAGTGGAGGATGG + Intronic
959597615 3:108145143-108145165 GGAGACACATCAGAGTTGGAAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961603914 3:128079638-128079660 GCATGCACAGCAGTGGTGGTGGG - Intronic
962608156 3:137049999-137050021 TGACACACAGAACTGGTGAAGGG + Intergenic
962660474 3:137596658-137596680 AGACACAGAGAAGGGGTGGAGGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963086895 3:141445353-141445375 GGAGACAAAGCAGTGGGGGCTGG + Exonic
963117605 3:141745183-141745205 GGACATGCAGCAGTTGTGGAAGG - Exonic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966331499 3:178819562-178819584 GGACACACAGGGGTAGAGGAGGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968487343 4:869776-869798 GCACACACAGCAGAGATGCATGG + Intronic
968504483 4:965569-965591 GGACACACAGCACTGGGGCCAGG + Intronic
968663946 4:1810608-1810630 GGACCCACAGCTGGGGTGGGAGG - Intergenic
968869959 4:3236765-3236787 GCACGCACAGCAGTGGGGGGTGG - Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
971367870 4:25992042-25992064 GCTCACACAGCTGTGGAGGAGGG - Intergenic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
972619974 4:40738020-40738042 GGGCACAGAGCATTGGAGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973296382 4:48526557-48526579 CCACACACAGCAGTGTTTGAAGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975844566 4:78511403-78511425 TGCCACACACCAGTGGTGGCTGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981869180 4:149465919-149465941 GGATACACTGCAGAGGTGGCAGG + Intergenic
982272863 4:153609217-153609239 GGAAACACAGTTATGGTGGAGGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983928309 4:173426382-173426404 GGACACAGATATGTGGTGGATGG - Intergenic
984710474 4:182880144-182880166 GGAAAGCCAGCTGTGGTGGAGGG + Intergenic
985699383 5:1361332-1361354 GGACACAGGGCTGGGGTGGAGGG + Intergenic
986182632 5:5407719-5407741 GCACTCACAGAAGTTGTGGAAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987556393 5:19456631-19456653 AAACACACATCAATGGTGGAAGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988985968 5:36619188-36619210 GGAAACAGAGGAGTGGGGGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992664673 5:78995523-78995545 GGAAACACAGCAGTTGTGAAAGG - Intergenic
992761232 5:79952448-79952470 GGACAGAAAGCAGAGCTGGAGGG - Intergenic
992932635 5:81665343-81665365 TGCCACACAGCACTGATGGATGG + Intronic
992980524 5:82166333-82166355 CAACACAAAGCAGTGGTGGTGGG - Intronic
992989971 5:82274265-82274287 GGACACAAGGCAGTGGGGAAAGG + Exonic
993099605 5:83521136-83521158 GCACACACTTCAGAGGTGGAAGG + Exonic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995441465 5:112197044-112197066 GACCACAAAGCACTGGTGGAGGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997199222 5:131999683-131999705 GGGCACACAGCAGTTCTGTAAGG + Intronic
998060588 5:139115642-139115664 GGACACACTGAAGTGCTAGAAGG + Intronic
998767249 5:145501625-145501647 GGACTCACAGTCATGGTGGAAGG - Intronic
1000038332 5:157465981-157466003 GGAGACCCTGCAGTGGAGGAGGG + Intronic
1001117632 5:168952941-168952963 GAACACACATCAGGGGTGAAGGG + Intronic
1001677720 5:173532288-173532310 GGAGCCGCAGCAGTGCTGGAGGG - Intergenic
1002111931 5:176921743-176921765 GGAGACTAAGCAGGGGTGGAGGG - Intronic
1003839353 6:10104282-10104304 AGACACTCAGCAGTGGTGCAGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004488488 6:16091116-16091138 GGACACACTGCTTTGGTAGAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005533559 6:26732860-26732882 GGACCAACAGCATTGTTGGAGGG + Intergenic
1005535091 6:26746816-26746838 GGACCAACAGCATTGTTGGAGGG - Intergenic
1005537236 6:26768794-26768816 GGACCAACAGCATTGTTGGAGGG - Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005879777 6:30047264-30047286 GGAAACACAATAATGGTGGAAGG + Intergenic
1006497297 6:34432992-34433014 GGTGTCACAGCAGGGGTGGAGGG + Intergenic
1006610580 6:35292102-35292124 GGATACACAGGAGTCATGGACGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008859127 6:56128038-56128060 GGACACACAATTGTGCTGGAAGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009790805 6:68399654-68399676 GGTCCCACAGCAATGGTGGTGGG - Intergenic
1010130619 6:72489159-72489181 TGACACAAAACAGGGGTGGAGGG - Intergenic
1010704091 6:79087141-79087163 GGCCTCACAGTCGTGGTGGAAGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012218088 6:96613472-96613494 GGTGACACAGCAGTGGGGGCAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014211225 6:118710237-118710259 GGACACACTGCAGCACTGGAGGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016361590 6:143273463-143273485 GGGGACACAGCAGAGGTGAATGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017235439 6:152113094-152113116 AGACACACAGCACTGGCGGCAGG - Intronic
1018092761 6:160359231-160359253 GAAGACACAGCAGTTGTGGTGGG + Intronic
1018231229 6:161677602-161677624 ACACACACTGCACTGGTGGATGG + Intronic
1018473034 6:164113207-164113229 GGCCTCACAACAATGGTGGAAGG - Intergenic
1018614150 6:165670096-165670118 AGCCACACACCAATGGTGGACGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021229602 7:18070119-18070141 GGAAACAAAGCTATGGTGGATGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023529762 7:41140189-41140211 GAAAACACAGAAGTGCTGGATGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024557403 7:50615384-50615406 GGCCACACAGCAGAGCTGGGAGG + Intronic
1024895875 7:54261348-54261370 GGAAACACAGTCATGGTGGAAGG + Intergenic
1024950967 7:54860089-54860111 GGACATACAGCAGCAGAGGAAGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026653127 7:72233253-72233275 GGACCCACTGCAGGGTTGGAAGG + Intronic
1027489285 7:78802551-78802573 GGAAACACAGGAGTGGAGCACGG + Intronic
1027957785 7:84903728-84903750 GGACTCACAACCATGGTGGAAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029113790 7:98226503-98226525 GGACACACAGTATGGCTGGAAGG + Intronic
1029171020 7:98628994-98629016 GGACAGACAGAAGGGGTGCACGG - Exonic
1029597957 7:101547511-101547533 GGACACACACCAGTGGGGGATGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1030882317 7:114895443-114895465 GGACACAAAGCAGTGTTAAAAGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1033170110 7:139076535-139076557 GGACACACAGCAGTGTCAGCTGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034469863 7:151249266-151249288 GCACACACAGCAGTGGACGCAGG - Intronic
1034495282 7:151417190-151417212 GGACACTCAGCTGATGTGGAGGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1039157200 8:34574377-34574399 GGACAGATAGCGGTGGTGGTGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040882278 8:52218859-52218881 GGACTCACAGCAATGGTGGGAGG + Intronic
1040940126 8:52824510-52824532 GCACACACAGCAGTGTTTTAGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044708886 8:95036265-95036287 GGACACAGATCAGTGATGAAAGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045342106 8:101264286-101264308 GGAAACTCAGAAGTGATGGAAGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046154401 8:110268401-110268423 GTAGACACAGCAGTGGTCAAGGG + Intergenic
1046527078 8:115394554-115394576 GGCCTCACAGTCGTGGTGGAAGG - Intergenic
1046611379 8:116429421-116429443 GGAAACACAGTCATGGTGGAAGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047880359 8:129186214-129186236 GGGCACAAAGCACTGGTGGTGGG - Intergenic
1048719606 8:137308536-137308558 GGACACACAACACTGGTAAAAGG + Intergenic
1049023063 8:139970909-139970931 GGAGTCACAGCTGGGGTGGAGGG - Intronic
1049133169 8:140867608-140867630 GGACTAACAAGAGTGGTGGATGG + Intronic
1050758429 9:9036743-9036765 GGACAAACAGGAGAGGAGGAAGG - Intronic
1051669621 9:19496397-19496419 TAACCCACAGCAGTGTTGGATGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1054708365 9:68485553-68485575 GGACTCACAATAATGGTGGAAGG - Intronic
1054778306 9:69142059-69142081 GGACACACAGGAATGGATGAGGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055857633 9:80710056-80710078 GGACACAGAGGAGAGGAGGAAGG - Intergenic
1056925038 9:90827233-90827255 GAACACACACCAGTTGAGGAGGG - Intronic
1057146583 9:92763354-92763376 GGACACACTCAAGTGGGGGAAGG + Intronic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1060347262 9:122828139-122828161 GGGGACACAGCAGCGGCGGAGGG + Intronic
1060824049 9:126677403-126677425 GGAGACATAGCAGTAGTGGGTGG - Intronic
1061205964 9:129163658-129163680 GGAGGCATAGCAGGGGTGGAGGG - Intergenic
1061287202 9:129630868-129630890 GGACACACAGCAACAGTGGGTGG - Intronic
1061900485 9:133669681-133669703 AGTCACACGGCAGAGGTGGAAGG - Intronic
1062402281 9:136377965-136377987 GGCCACACAGCAGTGGCTGGGGG - Exonic
1062575836 9:137207257-137207279 GGACACATTGCAGTGGTGTCAGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188168524 X:26892554-26892576 GCACCAACAGCAGTGGTGGTGGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189860490 X:45266140-45266162 GGACACACAGCATTAGTAAAAGG - Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1190058988 X:47198994-47199016 AGACACACAGGAGTGGAGCATGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192260062 X:69500688-69500710 GGACTCAGATCAGTGGTGAAGGG + Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195163869 X:102198246-102198268 GGACACAGAGGGTTGGTGGAGGG - Intergenic
1195194992 X:102488849-102488871 GGACACAGAGGGTTGGTGGAGGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197866901 X:131028693-131028715 GGCCTCACAGCAGTATTGGAAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199203704 X:145123578-145123600 GGCCTCACAACCGTGGTGGAAGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic