ID: 1136108065

View in Genome Browser
Species Human (GRCh38)
Location 16:28045161-28045183
Sequence CGTTGCACTTTCTGTGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136108065_1136108072 14 Left 1136108065 16:28045161-28045183 CCAAGCCCACAGAAAGTGCAACG 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1136108072 16:28045198-28045220 TAATGTAAACCGTGGACTTTGGG 0: 2
1: 58
2: 273
3: 565
4: 836
1136108065_1136108068 6 Left 1136108065 16:28045161-28045183 CCAAGCCCACAGAAAGTGCAACG 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1136108068 16:28045190-28045212 GTGAACCCTAATGTAAACCGTGG 0: 1
1: 68
2: 373
3: 764
4: 982
1136108065_1136108071 13 Left 1136108065 16:28045161-28045183 CCAAGCCCACAGAAAGTGCAACG 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1136108071 16:28045197-28045219 CTAATGTAAACCGTGGACTTTGG 0: 1
1: 56
2: 312
3: 639
4: 822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136108065 Original CRISPR CGTTGCACTTTCTGTGGGCT TGG (reversed) Intronic
901750159 1:11401610-11401632 TGTTGTACATTCTGTGGGTTTGG + Intergenic
902908259 1:19575432-19575454 TGTTGTACATTCTGTGGGTTTGG + Intergenic
903452110 1:23461153-23461175 TGTTGTACATTCTGTGGGATTGG - Intronic
908029843 1:59987541-59987563 CGGTGAACCATCTGTGGGCTTGG + Intronic
910326013 1:86007904-86007926 AGTTGTACTTTCTATGGGTTTGG - Intronic
911044220 1:93615528-93615550 TGGTGGACTTTCTGTGGCCTGGG - Intronic
911153223 1:94615242-94615264 CGTTTCACTTCCTGTTGTCTGGG + Intergenic
913204557 1:116525105-116525127 AGTTGTACATTCTGTGGGTTTGG + Intronic
915123385 1:153647005-153647027 GGTTGTACTTACTGGGGGCTGGG + Intergenic
915257127 1:154642135-154642157 TGTTGTACATTCTGTGGGTTTGG + Intergenic
915826191 1:159079738-159079760 TGTTGTACATTCTGTGGGTTTGG + Intronic
917850203 1:179056181-179056203 TGTTGCACATTCTGTGGGTTTGG + Intronic
918707927 1:187691617-187691639 CCTTGTACATTCTGTGGGTTTGG - Intergenic
919633455 1:199981424-199981446 TGTTGTACATTCTGTGGGTTTGG - Intergenic
919633484 1:199981727-199981749 TGTTGTACATTCTGTGGGTTTGG + Intergenic
920403418 1:205691699-205691721 CCTGGCACTTTCTGTGGGCCAGG + Intergenic
921243529 1:213212126-213212148 TGTTGTACATTCTGTGGGTTTGG + Intronic
921289521 1:213644416-213644438 TATTGCACTTTCTATGGGTTTGG + Intergenic
922186143 1:223276428-223276450 ATTTGCACTTACTGGGGGCTTGG + Intronic
922272616 1:224048124-224048146 TGTTGTACATTCTGTGGGTTTGG - Intergenic
923022914 1:230178815-230178837 TGTTACACATTCTGTGGGTTTGG + Intronic
1062866499 10:859972-859994 TGTTGTACGTTCTGTGGGTTTGG - Intronic
1062962159 10:1580651-1580673 TGTTGAACCTTCTATGGGCTTGG + Intronic
1063799001 10:9550135-9550157 TGTTGTACATTCTGTGGGTTTGG + Intergenic
1067183368 10:44006920-44006942 CTGTGCACATTCTGTGGGTTGGG + Intergenic
1068033164 10:51728209-51728231 CTTTGCACTTTCTCTTGTCTGGG - Intronic
1068636964 10:59358873-59358895 AGTTGCTCTATCTGTGAGCTTGG - Intronic
1069322860 10:67194660-67194682 TGTTGTACGTTCTGTGGGCTTGG - Intronic
1069847285 10:71381145-71381167 TGTTGTACATTCTGTGGGTTTGG - Intergenic
1071273770 10:84033491-84033513 TATTACACTTTCTGTGGGTTTGG + Intergenic
1072974089 10:100042627-100042649 AGTTCCAGTTTCTGAGGGCTGGG + Intronic
1072985673 10:100137819-100137841 TGTTGTACATTCTGTGGGTTTGG - Intergenic
1073351335 10:102822291-102822313 CGTCACAGTTTCTGTGGGATTGG - Intergenic
1073464749 10:103687914-103687936 CTTTGCACTTGCTGTGCCCTTGG + Intronic
1073654952 10:105404248-105404270 TGTTGTACTTTCTGTTGGTTTGG - Intergenic
1074622102 10:115136489-115136511 TGTTGGACATTCTGTGGGTTTGG + Intronic
1074736929 10:116445152-116445174 CTCTGCACTTACTGTGGGCTAGG + Intronic
1075805877 10:125188481-125188503 AGTGGCACATTCTGTGTGCTGGG - Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079293690 11:19211946-19211968 GGTTGTTCATTCTGTGGGCTTGG + Intergenic
1079514000 11:21245308-21245330 CTTGGCAATTTCTGTGGCCTTGG + Intronic
1081143416 11:39532527-39532549 CGTTGTACATTCTTTGGGTTTGG + Intergenic
1084764237 11:71297612-71297634 GGTTGCACATTCTGTGGGTTTGG - Intergenic
1089438993 11:118498774-118498796 TGTTGTACATTCTGTGGGTTTGG + Intronic
1090724513 11:129511725-129511747 AGTTTCTCTTTCTGTGGGATCGG + Intergenic
1092292785 12:7173707-7173729 TGTTGTACATTCTGTGGGTTTGG + Intergenic
1093591634 12:20908426-20908448 TGTTGAACTTTCTGTGGGTTTGG + Intronic
1095330526 12:40956443-40956465 CTTTCCATTTTCTGTGGACTAGG - Intronic
1096076192 12:48806725-48806747 TGTTGTACATTCTGTGGGTTTGG - Intergenic
1096268843 12:50147362-50147384 CATTGCACTCTCTCTGGCCTGGG + Intronic
1097497037 12:60352844-60352866 TGTTGTACATTCTATGGGCTTGG + Intergenic
1098762179 12:74438191-74438213 TGTTCCACTATCTGTTGGCTTGG - Intergenic
1099596904 12:84678496-84678518 GGATTCAGTTTCTGTGGGCTGGG - Intergenic
1100697232 12:97108354-97108376 TGTTGCATATTCTGTGGGTTTGG - Intergenic
1103370999 12:120419464-120419486 TGCTGCACATTCTGTGGGTTTGG - Intergenic
1103732859 12:123039649-123039671 TGTTGTACTTTCTGTGGGTTTGG - Intronic
1105993816 13:25650288-25650310 AGTTGAACTTTTTGTGGGGTAGG + Intronic
1107961166 13:45560509-45560531 TGTTGCACATTCTGTGGATTTGG + Intronic
1111271250 13:85889941-85889963 TGTTGCACACTCTGTGGGTTTGG + Intergenic
1115049393 14:29038668-29038690 CATTGCACTTTTTGTTTGCTTGG - Intergenic
1117153777 14:52916630-52916652 TGTTGTACATGCTGTGGGCTTGG - Intronic
1118095116 14:62527828-62527850 TGTTACACATTCTGTGGGTTTGG - Intergenic
1120632846 14:86911859-86911881 TGTTACACTTTCCGTGGGCTGGG - Intronic
1120658777 14:87228245-87228267 CCTTGCCCTTTCTTTGGGTTTGG + Intergenic
1120908135 14:89638871-89638893 TGTTGTACATTCTGTGGGTTTGG - Intronic
1121331686 14:93053585-93053607 TGTTGCACATTCTGTGGGTTTGG - Intronic
1121683651 14:95815460-95815482 CATTCCACTTTCTATGGGCTGGG + Intergenic
1121712366 14:96048245-96048267 TGTTGTACATTCTGTGGGCTTGG + Intronic
1122110477 14:99497136-99497158 TGTTGTACATTCTGTGGGTTTGG + Intronic
1122506104 14:102232832-102232854 TGGTGCACGTTCTGTGGGCTGGG - Intronic
1122769569 14:104092006-104092028 CTGTGCACTTGCTGTGTGCTAGG + Intronic
1124181261 15:27477519-27477541 TGTTGCACGTTCTATGGGTTTGG - Intronic
1124228603 15:27919717-27919739 TGTTGTACATTCTGTGGGTTTGG - Intronic
1124417258 15:29482395-29482417 TGTTGTACATTCTGTGGGTTTGG + Intronic
1124464570 15:29925196-29925218 TGTTACACTTTCTGCAGGCTGGG + Intronic
1125278191 15:38016006-38016028 TGTTGTACATTCTGTGGGTTTGG - Intergenic
1125498492 15:40220743-40220765 CTTTGCTCTTTCAGTGAGCTAGG + Exonic
1126279690 15:46930482-46930504 TGTTGCACATTCTATGTGCTTGG + Intergenic
1126605290 15:50470150-50470172 CTGAACACTTTCTGTGGGCTGGG + Intronic
1128210140 15:65892870-65892892 GCTTCCACTTTCTGTGGGTTTGG + Intergenic
1128610080 15:69066199-69066221 CTTTTCACTTTCTCTGGGCACGG + Intergenic
1129094193 15:73185225-73185247 TGTTGCAAATTCTATGGGCTTGG - Intronic
1131790258 15:95957151-95957173 TGTTGTACTTTCTATGGGTTTGG - Intergenic
1131917767 15:97289356-97289378 TGTTGTACGTTCTGTGGGTTTGG + Intergenic
1132208256 15:100001463-100001485 TGTTGCACATTTTGTGGGTTTGG - Intronic
1133151370 16:3834621-3834643 TGTTGTACATTCTGTGGACTTGG - Intronic
1134015325 16:10884050-10884072 TGTTGTACATTCTGTGGGTTTGG + Intronic
1134396644 16:13871227-13871249 TGTTGTACATTCTATGGGCTTGG - Intergenic
1135051523 16:19196774-19196796 CGTTGTGCATTCTGTGGGTTTGG + Intronic
1135528998 16:23236537-23236559 TGTTGCACATTCTATGGGTTTGG - Intergenic
1136088404 16:27901903-27901925 CTTTGCACTTGCTGTGCCCTTGG + Intronic
1136108065 16:28045161-28045183 CGTTGCACTTTCTGTGGGCTTGG - Intronic
1136234110 16:28903972-28903994 CGTTGCGCTGGCTGTGTGCTGGG + Intronic
1136929678 16:34407964-34407986 CGTTGGACTTCCTGGTGGCTGGG - Intergenic
1136974896 16:35003841-35003863 CGTTGGACTTCCTGGTGGCTGGG + Intergenic
1137436127 16:48455560-48455582 AGGGGCACTGTCTGTGGGCTGGG + Intergenic
1139558825 16:67729074-67729096 AGCTGCACTTTCTTTGGCCTTGG - Intronic
1144964587 17:19068414-19068436 TGTTGTACATTCTGTGGGTTTGG - Intergenic
1144983380 17:19183759-19183781 TGTTGTACATTCTGTGGGTTTGG + Intergenic
1144984845 17:19194480-19194502 TGTTGTACATTCTGTGGGTTTGG - Intergenic
1145251211 17:21297933-21297955 TGTTGCCCTTTCTGGGGGCCTGG + Intronic
1147691751 17:42319987-42320009 CATCGCCCTTCCTGTGGGCTGGG - Intronic
1151456655 17:74230418-74230440 CGTTGCACATTCTATAGGTTTGG - Intronic
1153055774 18:945013-945035 TCTTGCAGTTTCTGTGGGCTAGG + Intergenic
1153200062 18:2638601-2638623 TGTTGCACATTCTTTGGGTTTGG + Intergenic
1153404982 18:4727738-4727760 TGTTGCACATTCTATGGGTTTGG - Intergenic
1153792605 18:8593670-8593692 TGTTGTACTTTCTATGGGTTTGG - Intergenic
1155246637 18:23916835-23916857 AGTTGTACTTTCTGTTGGCTGGG + Intronic
1157605692 18:48924586-48924608 CATTGCAGTTTTTCTGGGCTGGG - Intronic
1158759359 18:60366196-60366218 TGTTGTACTTTCTATGGGTTTGG - Intergenic
1159935911 18:74367485-74367507 CCTTGCTGTTTCTGTGGGCCAGG - Intergenic
1162741522 19:12776239-12776261 CCTGGCACTTTCTATGGACTGGG + Intronic
1162743821 19:12788366-12788388 CATGGCTCTTACTGTGGGCTAGG - Intronic
1164579819 19:29427956-29427978 CGTTGCACTAGCTGTGTGATGGG - Intergenic
1167639931 19:50675602-50675624 GCTTGCCCTTCCTGTGGGCTGGG - Intronic
925032289 2:660280-660302 TGTTGTACTTCCTGTGGGTTTGG - Intergenic
925937931 2:8785360-8785382 TGTGGTACATTCTGTGGGCTTGG - Intronic
927682006 2:25145944-25145966 CGTTGTACATTCTGTGGGTTTGG + Intronic
928618800 2:33068487-33068509 TGTTGTACATTCTGTGGGTTTGG + Intronic
930894290 2:56427398-56427420 CTTTCCACCTTCTATGGGCTAGG + Intergenic
932515671 2:72345775-72345797 TGTTGTACATTCTATGGGCTTGG - Intronic
933969110 2:87455873-87455895 GGTTGCACCTTCTGTTGTCTTGG + Intergenic
936324680 2:111494635-111494657 GGTTGCACCTTCTGTTGTCTTGG - Intergenic
939569028 2:143818337-143818359 AGTTGCTCTTTCTGTGGGTTGGG - Intergenic
940303560 2:152201659-152201681 TGTTGCACACTCTGTGGGTTTGG + Intergenic
940768658 2:157817477-157817499 TGTTGTACATTCTGTGGGTTTGG - Intronic
941924802 2:170884273-170884295 CCTTGCAGTTTCTATGGGCCAGG - Intergenic
942202183 2:173582464-173582486 TGTTGCACTTCCCGTGGGATTGG - Intergenic
942269652 2:174261616-174261638 TGTTGTACATTCTGTGGGTTGGG - Intergenic
946671728 2:222112036-222112058 TGTTGCACGTTCTATGGGTTAGG - Intergenic
947921231 2:233876170-233876192 TGTTGTACATTCTGTGGGTTTGG + Intergenic
1169006797 20:2214027-2214049 TGTTGTACATTCTGTGGGTTTGG + Intergenic
1173325967 20:42034080-42034102 CCTTGCAGTTTCTGTGGGTCTGG + Intergenic
1173899153 20:46574433-46574455 CGTTGCACTGCCTCTGAGCTGGG + Intronic
1174381591 20:50159283-50159305 TGGTGTACATTCTGTGGGCTTGG + Intergenic
1177040247 21:16100042-16100064 CATTGCACTATCTGTAGGGTGGG - Intergenic
1178815182 21:35923079-35923101 CATTGTACATTCTGTGGGTTTGG - Intronic
1181684088 22:24516552-24516574 GCTTTCACTTTCTGTGGTCTTGG + Intronic
1182294571 22:29305518-29305540 CGTGGCACCTACTGTGTGCTGGG - Intergenic
1183276414 22:36900899-36900921 CGCTGTTCTTTCTGTGGGGTTGG - Intergenic
1183793059 22:40089742-40089764 TGTTGCACATTCTATGGGTTTGG + Intronic
1184622521 22:45692675-45692697 TTTTGCACTTTGTGTGGACTGGG + Intronic
949655519 3:6213929-6213951 TGTTGCACATGCTGTGGGTTTGG - Intergenic
950173895 3:10858360-10858382 TGTTCCACTTCCTGTGGGGTGGG - Intronic
950221949 3:11202806-11202828 TGTTGCACTTTCTGTGGGTTTGG + Intronic
950302968 3:11897986-11898008 TGTTGCACAGTCTGTGGGTTTGG + Intergenic
951905134 3:27698838-27698860 TGTTGTACATTCTGTGGGTTTGG - Intergenic
954994194 3:54866641-54866663 CTTTGCTCTTTCTGTGTTCTGGG - Intronic
955347525 3:58172105-58172127 TGTTCCACTTTCTGTAGGGTGGG - Intronic
955479333 3:59373705-59373727 GGTTGTACATTCTGTGGGTTTGG - Intergenic
955876539 3:63495899-63495921 TGCTGTACATTCTGTGGGCTTGG - Intronic
956305399 3:67818983-67819005 TGTTGGACATTCTGTGGGTTTGG - Intergenic
956438327 3:69256168-69256190 CTTTGCACTGTTTGTTGGCTTGG - Intronic
956731524 3:72200911-72200933 CGTTACAGTTGCTGTGGGCTAGG - Intergenic
958084184 3:88785001-88785023 TGTTGTACATTCTGTGGGTTTGG - Intergenic
959500056 3:107096642-107096664 TGTTGTACATTCTGTGGGTTTGG - Intergenic
960084428 3:113575421-113575443 TGTGACACTTTGTGTGGGCTGGG - Intronic
961696581 3:128709448-128709470 TGTTGTGATTTCTGTGGGCTAGG - Intergenic
961833612 3:129638736-129638758 CCTTTCACTTACTGTGAGCTGGG - Intergenic
962846408 3:139278049-139278071 CATAGCACCTTCTGCGGGCTGGG + Intronic
963339248 3:144014752-144014774 TGTTGTACATTCTGTGGGTTTGG - Intronic
965938012 3:174139162-174139184 TGTTGTACGTTCTGTGGGTTTGG + Intronic
966984420 3:185166377-185166399 TCTTGCAGTTTCTGTGGGTTAGG + Intergenic
967557929 3:190880317-190880339 TGTTGTACTTTCTATGGGTTTGG + Intronic
967959726 3:194910774-194910796 TGTTGTACATTCTATGGGCTTGG + Intergenic
969109661 4:4835962-4835984 TGTTGTACATTCTGTGGGTTTGG - Intergenic
970207557 4:13670015-13670037 GCATGCACTTTCTGTGTGCTAGG + Intergenic
971332573 4:25694387-25694409 TGTTGTACATTCTGTGGGTTTGG - Intergenic
972309153 4:37863921-37863943 TGTTGCACATTCTATGGGTTTGG - Intergenic
975910183 4:79258327-79258349 CGTTGCACTTTGCGGGGGCTGGG + Intronic
976701987 4:87979858-87979880 TGTAGCACTTACTGTGGGCTAGG - Intronic
977056245 4:92195623-92195645 TGTTGTACACTCTGTGGGCTTGG - Intergenic
978702341 4:111662682-111662704 TGTTGCTCTTACTGTGTGCTAGG + Intergenic
979882554 4:125980092-125980114 TGTTGGACGTTCTGTGGGTTTGG - Intergenic
981341286 4:143624677-143624699 CTATGAACTTTCTGGGGGCTGGG - Intronic
981680069 4:147387452-147387474 AGTTACTCTTTCTTTGGGCTTGG - Intergenic
982807320 4:159782556-159782578 GGTTGCACATTCTGTGGGTTTGG + Intergenic
984709553 4:182873830-182873852 CGGTGACCTTTCTGCGGGCTGGG - Intergenic
985308106 4:188565837-188565859 TGTTAGACATTCTGTGGGCTTGG + Intergenic
988372997 5:30396415-30396437 CATTGCACATTCTGTGGGATAGG + Intergenic
988669850 5:33369917-33369939 CTTTGGGCTTTCTGTGGGATAGG + Intergenic
990582120 5:57174669-57174691 CGTGGCACTTGCCGTGGACTGGG + Intronic
992600957 5:78398862-78398884 TGTTGTACATTCTGTGGGTTTGG + Intronic
995008619 5:107232162-107232184 TGTTGCACATTCTGTGGGTTTGG - Intergenic
995308129 5:110678569-110678591 TGTTGCACATTCTATGGGTTTGG + Intronic
998777672 5:145620343-145620365 TGTTGCACATTCTGTAGGCTCGG - Intronic
998962270 5:147501411-147501433 TGTTGCACATTTTATGGGCTTGG - Intronic
999427848 5:151503171-151503193 TGTTGCACATTCTATGGGTTTGG - Intergenic
999979218 5:156941778-156941800 GGTTGCACTTTATGTGGCATAGG - Intronic
1000704577 5:164494659-164494681 TGTTGCACATTCTTTGGGTTTGG + Intergenic
1001499797 5:172221799-172221821 TGTTGTACATTCTGTGGGTTTGG - Intronic
1001751712 5:174136446-174136468 TCTTGCACTGTCTGTGGCCTGGG - Intronic
1002133797 5:177096382-177096404 CCTTGCCCTTTTTGTGGGGTAGG - Intronic
1002596570 5:180327634-180327656 CTGTGCACTTACTGTGTGCTGGG - Intronic
1003046568 6:2738856-2738878 TGCTGCACATTCTGTGGGTTTGG - Intronic
1003853592 6:10250261-10250283 CTTTGCACTTTCTGTCCCCTTGG + Intergenic
1004488203 6:16088245-16088267 CGTAGCACTTACTGTGTGCGAGG + Intergenic
1007393650 6:41564913-41564935 CTTTGGACCTTCTGTGGCCTGGG + Intronic
1007883281 6:45191511-45191533 TGTTTCACATTCTGTGGGTTTGG - Intronic
1011500125 6:87979070-87979092 TGTTGTACATTCTATGGGCTTGG + Intergenic
1012926033 6:105268835-105268857 TGTTGTACATTCTGTGGGTTTGG - Intergenic
1013297464 6:108770719-108770741 TGTTTGACTTTCTGTGGGCTTGG - Intergenic
1017828426 6:158100976-158100998 TGTTGCACATTCTATGGGCTTGG + Intergenic
1018167588 6:161113471-161113493 TGTTGCACATTCTATGGGTTTGG - Intronic
1018514827 6:164567973-164567995 CTGTGCACTTACTGTGGTCTGGG + Intergenic
1020014738 7:4824386-4824408 GGTGGCATTTCCTGTGGGCTTGG - Intronic
1021396505 7:20155532-20155554 AGTTTCACTTTCTGTGGTTTGGG - Intronic
1023407694 7:39852593-39852615 TGTTGTACATTCTGTGGGTTTGG + Intergenic
1024634974 7:51279676-51279698 TGTCGCACATTCTGTGGGTTAGG + Intronic
1024854770 7:53765235-53765257 TGTTGAACATTCTGTGGGTTTGG + Intergenic
1025223976 7:57140711-57140733 CATTGCTGTTTCTGTGAGCTGGG + Intergenic
1027575093 7:79921911-79921933 CTCTGCACTTTCTGAGGCCTTGG + Intergenic
1028831304 7:95329197-95329219 CCTCTCACTTTCTGTGGGCCAGG + Intergenic
1030859585 7:114608194-114608216 TTTTGCAGTTTCTGTGGGTTAGG + Intronic
1030910388 7:115241037-115241059 TGTTGCACATTCTGTGGGTTTGG + Intergenic
1033139306 7:138810759-138810781 TGTTGTACATTCTGTGGGTTTGG - Intronic
1035862941 8:3049712-3049734 TGTTGCACCATCTGTGGGCTTGG - Intronic
1036711940 8:11085392-11085414 CTTGGCACTCTCCGTGGGCTAGG - Intronic
1037763077 8:21755161-21755183 TGTTGTACGTTCTGTGGGTTTGG - Intronic
1038394671 8:27238065-27238087 CCTAGAACTTTCTGTGGCCTAGG + Intronic
1038490785 8:27969599-27969621 TGTTGAACATTCTGTGGGTTTGG - Intronic
1039333346 8:36563116-36563138 TGTTGCACGTTCTGTGGGTTTGG - Intergenic
1042253779 8:66782528-66782550 TGTTGTACATTCTGTGGGTTTGG + Intronic
1042735201 8:71979705-71979727 CATTGCACTCTCCTTGGGCTTGG - Intronic
1043800974 8:84608993-84609015 CTTTGCACTAGCTGTGGGATTGG - Intronic
1043828870 8:84963627-84963649 GGTTGTACTTTCTATGGGTTTGG - Intergenic
1045229738 8:100292327-100292349 CATTTCACTTTCTGTGCACTAGG + Intronic
1046929561 8:119828495-119828517 TGTTGCAGTTTCTGTTGCCTAGG - Intronic
1050098180 9:2089702-2089724 CCTTGGACTTCCTGTGGTCTTGG + Intronic
1050161216 9:2720202-2720224 CATTGCACTGTCAGTGGCCTTGG - Intronic
1050200038 9:3135058-3135080 TGTTGGACATTCTGTGGGTTTGG - Intergenic
1051981076 9:23017820-23017842 TGTTGCACATTCTGTGGGTTTGG + Intergenic
1053482424 9:38425472-38425494 CGTTGCGCCTTCTCTGGGCCAGG + Intergenic
1056626666 9:88259230-88259252 CATTGTACATTCTGTGGGCTTGG + Intergenic
1056760240 9:89409352-89409374 TGTTGTACATTCTGTAGGCTCGG - Intronic
1057858669 9:98622917-98622939 TGTTGTACATTCTGTGGGTTTGG - Intronic
1060147658 9:121266678-121266700 CTTAACCCTTTCTGTGGGCTTGG + Intronic
1062383699 9:136299777-136299799 CGTTTCCCCATCTGTGGGCTGGG + Intronic
1203358623 Un_KI270442v1:190509-190531 GGTTGGAATTTCTGTGGGATCGG + Intergenic
1185761583 X:2692819-2692841 TTTTGCACCTACTGTGGGCTTGG + Intronic
1185949531 X:4416095-4416117 TGTTGTACATTCTGTGGGTTTGG + Intergenic
1187181852 X:16949924-16949946 TGTTGTACATTCTGTGGGTTTGG + Intronic
1188256484 X:27967249-27967271 TGTTGCAGTTTCAGTAGGCTGGG - Intergenic
1188342887 X:29027084-29027106 TGTTGTACATTCTGTGGGTTTGG + Intronic
1190971469 X:55353096-55353118 AGTCGAACTTTCTGTGGGCTGGG + Intergenic
1192736949 X:73858614-73858636 CACTGCACTTTCTGTAGCCTGGG - Intergenic
1196000326 X:110776890-110776912 TATTGCACATTCTGTGGGTTTGG + Intronic
1196655451 X:118213027-118213049 GGTCACTCTTTCTGTGGGCTGGG - Intergenic
1197241167 X:124124784-124124806 TGTTGTACTTTCTATGGGTTTGG - Intronic
1197802897 X:130370882-130370904 TTTTGCAGTTTCTGTGGGCCAGG + Intronic
1198480733 X:137037455-137037477 TATTGCACATTCTGTGGGTTTGG + Intergenic
1199485027 X:148338097-148338119 AGTTGCACTGCCTGAGGGCTGGG - Intergenic
1201736719 Y:17271044-17271066 TGTTGCACATTCTGTAGGTTTGG + Intergenic