ID: 1136110844

View in Genome Browser
Species Human (GRCh38)
Location 16:28063021-28063043
Sequence CCGCGCCGCCCCGGGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 12, 3: 39, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136110828_1136110844 26 Left 1136110828 16:28062972-28062994 CCAGGCGGCGGGAGGAGGGCGAA 0: 1
1: 0
2: 2
3: 18
4: 227
Right 1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG 0: 1
1: 1
2: 12
3: 39
4: 291
1136110837_1136110844 -2 Left 1136110837 16:28063000-28063022 CCGGGGCTCGGGCCTCGATGGCC 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG 0: 1
1: 1
2: 12
3: 39
4: 291
1136110827_1136110844 27 Left 1136110827 16:28062971-28062993 CCCAGGCGGCGGGAGGAGGGCGA 0: 1
1: 0
2: 2
3: 25
4: 236
Right 1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG 0: 1
1: 1
2: 12
3: 39
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136110844 Original CRISPR CCGCGCCGCCCCGGGGGAGC CGG Intronic
900109736 1:1000391-1000413 CCGCCCAGCCCCGGGGGTCCCGG - Intergenic
900831969 1:4971895-4971917 CCGTGCCTCCCTGGGGCAGCAGG + Intergenic
901201572 1:7470208-7470230 CCGCACAGACCTGGGGGAGCAGG - Intronic
902246514 1:15124474-15124496 CCGGGCCGCGCCTGGGGCGCAGG - Intergenic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902348260 1:15835113-15835135 CCGCCCCGCCCAGGGGCAACAGG + Intergenic
904769017 1:32870761-32870783 CTGCGCCGCCCCGGGCCTGCCGG - Exonic
905580889 1:39082001-39082023 CCGCGCCGCCCCAGGCTCGCGGG + Intronic
905647193 1:39633013-39633035 CCGCCCCGCCCCCGGGGATCGGG - Intronic
906204378 1:43979303-43979325 CCGAGCCGCCCCGGGGGGCAGGG - Intronic
906318013 1:44800521-44800543 CCGGGCCCGGCCGGGGGAGCGGG - Exonic
906321506 1:44820310-44820332 CGGCGCCGCCCACGGGGTGCGGG - Intronic
907357642 1:53889637-53889659 CCGCGGCGGCCCGGGCGGGCAGG + Intronic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
912391736 1:109307502-109307524 GCCCGCTGCCCCCGGGGAGCGGG - Intergenic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
919739260 1:200972491-200972513 CCCCGCCTTCCCGGGGGCGCTGG + Intronic
920435396 1:205943730-205943752 CAGGGCCGCCTTGGGGGAGCCGG - Intergenic
922200097 1:223393914-223393936 CCGCCTTGCCCCGGAGGAGCTGG + Exonic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
923056065 1:230426412-230426434 CCGGACAGCCGCGGGGGAGCTGG + Intergenic
924778369 1:247126692-247126714 CCGCGCCGCGCCGCGCCAGCAGG - Intronic
924783289 1:247171728-247171750 CCGCGCCGCGCCGCGCCAGCAGG + Intronic
1064209102 10:13348177-13348199 CGGCGCGGCCCTGCGGGAGCCGG + Exonic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1065367865 10:24952702-24952724 CCGCCCCGCCCCGGGCCCGCCGG + Intergenic
1070570706 10:77637913-77637935 CAGCGCAGCCCGGGGCGAGCGGG - Intronic
1071794673 10:88991363-88991385 GCGCGCCGCCCCGCGGGGGCGGG + Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1073057848 10:100713635-100713657 CCTGGCCGCGCAGGGGGAGCTGG + Intergenic
1073196456 10:101695190-101695212 CCGCGCCGCCCCATGTGACCCGG - Exonic
1074753720 10:116609689-116609711 CCGCCTCGACCCAGGGGAGCAGG - Intergenic
1075129351 10:119725609-119725631 CCGCACCGCTCCGGGAGAGCGGG + Intergenic
1075684520 10:124354258-124354280 CCGAGACCCCCCGGGGGAGAGGG + Intergenic
1075796482 10:125123673-125123695 CCCCGGGGCCCCTGGGGAGCCGG - Intronic
1076402568 10:130193559-130193581 ACCCGCCGACCCGGGAGAGCTGG - Intergenic
1076904982 10:133357153-133357175 CCGCCCTGCCCTGGGGGACCTGG + Intronic
1076948727 10:133667510-133667532 CATCGCCGCCCGGGAGGAGCTGG + Exonic
1076949711 10:133670809-133670831 CATCGCCGCCCGGGAGGAGCTGG + Intronic
1076950695 10:133674108-133674130 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076951685 10:133677418-133677440 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076952674 10:133680728-133680750 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076953658 10:133684027-133684049 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076955631 10:133743689-133743711 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076956621 10:133746999-133747021 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076957608 10:133750308-133750330 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076958593 10:133753607-133753629 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076959582 10:133756917-133756939 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076960566 10:133760216-133760238 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1077093557 11:790037-790059 GCGCGCAGCCCCGGGGAGGCCGG - Exonic
1077227681 11:1445504-1445526 GAGCGCTGCCCCGGAGGAGCCGG + Intronic
1078527239 11:12110484-12110506 CCGCCCCGCCCCCGTGGGGCCGG - Intronic
1080012436 11:27472368-27472390 CCCCGCCGCCCCCGGGCAGCCGG + Exonic
1081578356 11:44334007-44334029 CCGCCCCGCCCCAGGGGCGCAGG - Intergenic
1081636882 11:44727325-44727347 CCGCCGCGCCCCCGGGGACCTGG + Intronic
1081938076 11:46918412-46918434 CCGCGCCGTCCGGCGGGAGCCGG - Exonic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1083596258 11:63919426-63919448 CCCCGCAGCCCCGGGGCGGCAGG - Intergenic
1083602532 11:63957892-63957914 CAGCCCTGGCCCGGGGGAGCTGG + Intergenic
1083747652 11:64744660-64744682 CCGCGCCGCCCTGGGCGGGGGGG + Intronic
1083970452 11:66070860-66070882 CGGCGGGGCGCCGGGGGAGCGGG + Intronic
1084128705 11:67118238-67118260 CCGCGACGGCCCGGGGGCGGTGG - Intergenic
1084304407 11:68272113-68272135 CCGAGCCGGCCCCGGGGAGGCGG - Intergenic
1084524258 11:69686064-69686086 CTGCGGCTCCCCGGAGGAGCGGG - Intergenic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1085597019 11:77820173-77820195 CCCCGCCGCCAAGGGGGAGACGG + Intronic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1090230791 11:125102131-125102153 CCTCGCCGCCCCGGAGGCTCTGG + Exonic
1090647458 11:128777242-128777264 CCCCGAGGCCCCGGGGGAGGTGG + Intronic
1091349387 11:134880974-134880996 CCGGGCTGCCCCGGGGGCGCTGG + Intergenic
1093931136 12:24956094-24956116 CCGCCCCCGCCCCGGGGAGCTGG + Intergenic
1096459467 12:51814332-51814354 CCGCGGCGCGCCGGGGGCGCGGG + Intergenic
1097166018 12:57087282-57087304 CAGCGCCGCCCCAAGGGGGCCGG + Intronic
1101592849 12:106139046-106139068 TCGCGCGGCCCCAGGGGAGGGGG + Exonic
1102679981 12:114684730-114684752 TCTCCCCGCCCCGGGCGAGCCGG + Intergenic
1103800516 12:123534179-123534201 CCAGGCCGCCCCGGGAGAGGGGG + Intergenic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1104944280 12:132408777-132408799 CCACACGGCCCCAGGGGAGCAGG + Intergenic
1106720023 13:32427613-32427635 CCGCGCTGTCCCGGGGGGGACGG - Intronic
1108373380 13:49792382-49792404 CCGCGCCGGCCCGGCGACGCGGG - Intronic
1112046674 13:95604336-95604358 CCCTGCCGCCCTGGGGAAGCTGG + Intronic
1112402085 13:99086380-99086402 CCGGGCCGGGCCGCGGGAGCAGG - Intronic
1113834060 13:113317239-113317261 CTGCGCTGCCCGGGGGGAGATGG - Intronic
1113936182 13:113996265-113996287 AGGCCCTGCCCCGGGGGAGCGGG - Intronic
1114519084 14:23321700-23321722 CCGCGCCCCCCCGGGAGCTCCGG + Exonic
1114653215 14:24299796-24299818 CCGCGCCGCCCCAGCCGGGCGGG - Exonic
1115610661 14:35046235-35046257 CCGCCCCGCCCCGCGCGAGCCGG + Intronic
1116186798 14:41608299-41608321 CGGCTCCGCGCCCGGGGAGCGGG - Exonic
1116817806 14:49599653-49599675 CCGGCCGGCCCCGGGGGAGACGG - Intronic
1117377407 14:55129179-55129201 CCGCCCCGCCTCGGGAGAGGCGG + Exonic
1117722180 14:58638419-58638441 CTGCGCGGCGCCGGGGGTGCGGG + Exonic
1118404982 14:65413405-65413427 TGGCGCAGCCCCGGGGGCGCGGG + Intronic
1121751768 14:96363461-96363483 CCGCCCCGCCCCCTCGGAGCCGG - Exonic
1121803796 14:96797239-96797261 CCGCGCCTCCCCGGGAATGCCGG - Intergenic
1122436713 14:101705989-101706011 CCGCGGCGGACCGGGGGAACTGG - Intergenic
1122517627 14:102319826-102319848 CCGCTCTGGCCCGGAGGAGCCGG - Exonic
1122604327 14:102938265-102938287 CCCCGCAGCCCTGGGGGAGGTGG - Intronic
1122940281 14:104978138-104978160 CCCACCCGCCCCAGGGGAGCGGG + Intronic
1124956959 15:34366405-34366427 CCGCGCCAGCCTAGGGGAGCTGG - Intronic
1126786201 15:52179637-52179659 CCGCGCCACCGCCCGGGAGCAGG - Intronic
1128309641 15:66622210-66622232 CCTCGCCGCCCCCGGGCTGCCGG + Intronic
1129736995 15:77972167-77972189 ACGTGCCTCCCCAGGGGAGCGGG + Intergenic
1130390067 15:83447456-83447478 CCGCGACGCGCTCGGGGAGCGGG - Exonic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1132494424 16:254539-254561 CCGCTCGGCACCGGGAGAGCCGG - Exonic
1132583070 16:694152-694174 CCGCGCTGGGCCGGGGGCGCGGG + Exonic
1132601553 16:775219-775241 CCGTGCCGCCCAGGGGGACGTGG - Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133259223 16:4537894-4537916 CCGCGCATCCCCGGCGGAGATGG - Intronic
1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG + Intronic
1135251051 16:20901018-20901040 CCGAGCCGCCCCCGCGAAGCTGG - Intronic
1135479921 16:22814073-22814095 CCGCGCCGCGCCCAGGGACCTGG - Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1137788534 16:51155369-51155391 CAGCGGCGCCCCGGGGGCGGGGG + Intergenic
1138265475 16:55656849-55656871 ACGCGCAGCCCCGGGAGACCTGG + Exonic
1139489640 16:67279449-67279471 CCGCGCCGCCCCCTGGAGGCCGG - Exonic
1141054909 16:80804942-80804964 CCGCGCAGCCCCGAGGGGCCAGG - Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141830931 16:86509811-86509833 CCGCGCCGCCCGGGCGGGGAAGG + Intergenic
1142411200 16:89918106-89918128 GCGCGCCGCCCGGGGAGGGCGGG + Exonic
1142863405 17:2776812-2776834 CCCCGCCGCCCCGGAGGAGGAGG + Intergenic
1143053282 17:4143893-4143915 CCGCGGCGGCCCAGGGGACCCGG + Exonic
1143155428 17:4833453-4833475 CCGCGCCTCCCCCGGAGACCGGG - Exonic
1143174354 17:4947949-4947971 CCGCCCCGCCCTGGGAGAGGCGG + Intronic
1144872753 17:18380946-18380968 CAGCGCCGACCAGGTGGAGCGGG + Exonic
1145828165 17:27893065-27893087 CCGGGCGGCCTCGGAGGAGCAGG - Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1147264054 17:39224699-39224721 CCGCGCCCCACCACGGGAGCGGG - Intronic
1148081716 17:44970528-44970550 CCACACCGCGCCAGGGGAGCAGG - Intergenic
1148154261 17:45413691-45413713 CCACCCCGCCCTGGAGGAGCAGG - Intronic
1148722509 17:49763965-49763987 CAGCCCAGCCCGGGGGGAGCCGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149614442 17:57987279-57987301 CCGGGCCGGCCCGGGGCAGGCGG - Intronic
1149658880 17:58324379-58324401 CACCGCCGCCCCCGGGTAGCTGG + Intronic
1150220765 17:63494566-63494588 CAGGGCAGACCCGGGGGAGCCGG + Intronic
1150643533 17:66964823-66964845 GCGCGCCGCTCCGGGGGCGCCGG - Intergenic
1151826666 17:76527699-76527721 CAGGGCAGCCCCGGGGGATCCGG - Exonic
1152396289 17:80035709-80035731 CAGCGCCCCCTCGGCGGAGCTGG - Intronic
1152648564 17:81481585-81481607 GCGGGCCGGCCCGGGGGAGGGGG + Intergenic
1154125636 18:11689716-11689738 CTTCGCCGCCCCGAGGGAGCAGG - Exonic
1155928722 18:31684805-31684827 CCGCGGCGCCCCTGCGGAGAGGG + Intronic
1157584767 18:48794024-48794046 CCTCGCCTCCCCTGGGGAGATGG - Intronic
1158137583 18:54224181-54224203 CGGCGCCCCCCGGCGGGAGCCGG - Exonic
1158435710 18:57434732-57434754 CCGCGCCGCCCGTGGGCCGCCGG + Intergenic
1159260414 18:66005912-66005934 CCGCACCGCACCGGGGCTGCAGG + Intergenic
1160165373 18:76506813-76506835 CTGTGCCACCCCGGGGGAGAGGG + Intergenic
1160690138 19:457921-457943 CCGCACAGACCCGGGGGAGGCGG + Intronic
1160816842 19:1040006-1040028 CCGCGCAGCTCCGACGGAGCAGG + Intergenic
1160967626 19:1753567-1753589 GCGCGCAGCCACCGGGGAGCGGG + Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1160988721 19:1852001-1852023 GCGAGCAGCCCCGGGGGCGCAGG + Intergenic
1160992354 19:1864866-1864888 CCCCGCCGCCCCGCCGGAGCTGG - Intergenic
1161101874 19:2425501-2425523 CCGCCCCGGCCCAGGGGACCAGG + Intronic
1161222037 19:3122317-3122339 GAGCGCCGCCCCCGGGGAGCGGG + Exonic
1161260756 19:3336710-3336732 CCCCACCTCCCAGGGGGAGCTGG + Intergenic
1161296734 19:3523931-3523953 CCGCACCGCACAGGGGGAGAAGG - Intronic
1161483342 19:4521750-4521772 CCGCCCAGCCCCAGGGGAGTCGG + Intergenic
1161660687 19:5544145-5544167 CCGGGCCTCCCTGGGGGAGAGGG - Intergenic
1161768061 19:6217579-6217601 CCTCGCTGGCCCTGGGGAGCGGG + Intronic
1162832977 19:13298662-13298684 CCTCGCCGCCCCGGGCCGGCCGG + Exonic
1163158155 19:15449971-15449993 CGGCGGCGCGCCGGGGGGGCGGG - Intergenic
1163158208 19:15450071-15450093 CCTCGCCGCCCCGGGGGGGGCGG + Intergenic
1163370377 19:16897853-16897875 CCGGGCCGGGCCGGGGGTGCGGG + Intronic
1163714646 19:18866691-18866713 CCTCGCCGCCGCGGGCCAGCAGG - Exonic
1165275630 19:34748627-34748649 CCACACCACCCAGGGGGAGCAGG - Intergenic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1166043815 19:40218019-40218041 GCGCGCCGGCCCGGGGCTGCTGG + Exonic
1166317880 19:41998885-41998907 CCCCGCCGGCCCCCGGGAGCTGG - Exonic
1166869757 19:45864233-45864255 GCGCGCCGCCCTCGGGGAGGCGG + Intronic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
925927046 2:8678255-8678277 CCTCTCCGCCCTGGGGGAGCCGG - Intergenic
927422089 2:22944354-22944376 CCGCCAGGCCCCGGGGCAGCAGG + Intergenic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
927909588 2:26887432-26887454 CCCCGCAGGCCCAGGGGAGCTGG + Intronic
928546632 2:32334933-32334955 CCGCCCCGCCCCCGAGTAGCTGG - Intergenic
929242433 2:39666199-39666221 CCGGGCCGCCCGGGAGCAGCCGG - Exonic
929966790 2:46542709-46542731 CCGGCCGGCCCCGGGGGAGACGG - Exonic
933684611 2:85133419-85133441 CTGGGACGCCCCGGCGGAGCAGG + Exonic
934664967 2:96163661-96163683 CCAGGCCTCCCTGGGGGAGCCGG + Intergenic
934697122 2:96407867-96407889 CCGGGCCCCTCTGGGGGAGCTGG - Intergenic
934978333 2:98821911-98821933 CGACGCCGGCCCGGGAGAGCGGG - Exonic
935349722 2:102142808-102142830 CGGCGCCGGCCGGGAGGAGCCGG + Exonic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
942178396 2:173355894-173355916 AGTCGCCGCCCCGGTGGAGCTGG + Intronic
942565744 2:177264111-177264133 CCGCGCAGCCCCGGAAGGGCCGG + Intronic
942565906 2:177264624-177264646 CCGCGCCGCGCCTCGGCAGCCGG - Exonic
946404061 2:219483526-219483548 CCGGGCCGGGCCGCGGGAGCTGG + Exonic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948374232 2:237510742-237510764 CCGCGTCCACCCGGAGGAGCAGG + Exonic
948726286 2:239936024-239936046 CTGCCCAGCCCTGGGGGAGCCGG - Intronic
1169558145 20:6770168-6770190 CCGCGCCGCCCAGGAGGACCTGG - Exonic
1170596098 20:17806950-17806972 CCCAGCCGCCCCGGGGGGGCAGG + Intergenic
1171013857 20:21522775-21522797 CCGCGCAGCCCCAGCGGAGGGGG + Intergenic
1171977614 20:31605514-31605536 TCGCGCTGCGCCGGGGGCGCCGG + Exonic
1172118177 20:32583830-32583852 CCGGGCCGGCCCGGGGGACGGGG + Intronic
1172618665 20:36306295-36306317 CCCCGCCGCTCTCGGGGAGCCGG + Intergenic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1174658620 20:52191903-52191925 CCCCAACGCCCCCGGGGAGCTGG + Exonic
1175215806 20:57391305-57391327 CCGCCCCGCCCCGGGCGCGCGGG - Intergenic
1175847596 20:62066483-62066505 CCAAGCCGCCGCGGGGAAGCTGG + Intergenic
1175923094 20:62459075-62459097 CCTCGCAGCCTCGGGGGTGCCGG + Intergenic
1176048076 20:63102868-63102890 GCGGGCCGCTCCGGGGAAGCGGG + Intergenic
1176199760 20:63854994-63855016 CCAGGCCGTCCCTGGGGAGCTGG - Intergenic
1176549076 21:8213727-8213749 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176556970 21:8257947-8257969 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176568008 21:8396765-8396787 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176575912 21:8440984-8441006 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1180105469 21:45615611-45615633 CAGAGCAGCCCCGGGGGGGCAGG + Intergenic
1180650078 22:17369949-17369971 CCGCGCGGGGCAGGGGGAGCAGG - Intronic
1180983805 22:19892374-19892396 CCGCGCCGCCCTCGGGAAGCAGG + Intronic
1181169906 22:21002173-21002195 CCGCCCCGCCCCGGTGGCGGGGG - Intronic
1182278710 22:29206080-29206102 CAGCGCCGCCTCCCGGGAGCAGG - Exonic
1182532297 22:30969617-30969639 CCGCCCCGCTCCGGGGGAGGCGG + Intergenic
1183578217 22:38706023-38706045 CCTGGCCGCCCCCGGGGAGCTGG - Exonic
1184674276 22:46032075-46032097 CGGCCCAGCCCCGGGGGAGGAGG + Intergenic
1185278869 22:49961429-49961451 TCGCGCCGCCCTGGGGGACACGG - Exonic
1185388423 22:50546990-50547012 CCGCGGCGCCCAGGCGGAGCGGG - Intergenic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
1203253963 22_KI270733v1_random:130042-130064 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203262019 22_KI270733v1_random:175121-175143 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
950084620 3:10248647-10248669 CCGAGCGGCCCCTCGGGAGCTGG - Exonic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950656757 3:14441427-14441449 GCGCCCGGCCCCGAGGGAGCAGG + Intronic
953439613 3:42906419-42906441 CCGCGCTGCCCCGGGCGCGCCGG + Exonic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
958714630 3:97764688-97764710 CCACGCCTCCCCGGGGGTCCTGG - Exonic
960971549 3:123143487-123143509 CCTGGCAGCCCCAGGGGAGCCGG - Intronic
961780798 3:129319114-129319136 CCACGGTGCCCCGGGGGACCTGG + Intergenic
963827398 3:149970529-149970551 CAGCGCAGCCCCGGGTGAGGGGG + Intronic
965590365 3:170356816-170356838 CCGCCCCGCCCCGGCGGCCCCGG - Intergenic
965793200 3:172411349-172411371 CTGCGCCTCGCCTGGGGAGCGGG + Intergenic
966762082 3:183427797-183427819 GCGCGCTGCCCCGGGGCAGCGGG + Intronic
968093048 3:195909774-195909796 CTGCGCCGCCCCGGGGTGGGGGG + Intronic
968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG + Intronic
968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG + Intergenic
968636668 4:1684431-1684453 CCGCGCCGCGCCGACGGAGGGGG + Intergenic
969694121 4:8725291-8725313 CCGGGCCGCCACAGGGCAGCTGG + Intergenic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
970425076 4:15938432-15938454 CCACGCCCCTCCGAGGGAGCCGG + Exonic
972290489 4:37686304-37686326 ACGCGGCGCCCTGGGGGAGGAGG - Exonic
972686837 4:41360545-41360567 CCGCTCCGCCCCCGGGGAGGGGG - Intronic
972766001 4:42152489-42152511 CCGCGCCTCCGACGGGGAGCGGG + Intronic
977176556 4:93827396-93827418 CTGCACCGCCCCTGGGGCGCGGG - Intergenic
983926053 4:173403472-173403494 CTGCGCCGCCCCGGGAATGCTGG + Intronic
985444576 4:190015051-190015073 CACCGCCACCCCGGGGCAGCGGG - Intergenic
985446191 4:190022284-190022306 CATCGCCGCCCGGGAGGAGCTGG - Intergenic
985452181 4:190068294-190068316 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985453165 4:190071591-190071613 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985454155 4:190074884-190074906 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985455143 4:190078177-190078199 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985456131 4:190081477-190081499 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985457115 4:190084771-190084793 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985458102 4:190088064-190088086 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985459091 4:190091364-190091386 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985463344 4:190174133-190174155 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985512873 5:321958-321980 CCGCCCCGTCCCGGGGCCGCCGG - Intronic
985696717 5:1345027-1345049 CCGCGGCGCCAGGTGGGAGCGGG - Exonic
987035157 5:14011843-14011865 CCGCGCCGCGCTGGGGGCGGTGG - Intergenic
988264797 5:28934191-28934213 CCCCCCCGCCCCGGAGGAGAGGG + Intergenic
991263448 5:64690689-64690711 CCTCGCCGCGCCGGGGGCACTGG - Exonic
993116145 5:83722201-83722223 CCGCGCCGCCCCGCCGGGGCCGG - Intergenic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
997513148 5:134466612-134466634 CCGGGCACCCCCGGGGCAGCCGG - Intergenic
997521518 5:134526817-134526839 CCGCGCGGCCCCGGAGGTGGAGG - Intronic
997912437 5:137889367-137889389 GCTCGCCGCCCTGGAGGAGCTGG + Intronic
998166797 5:139848734-139848756 CCGGGCCGGCGCGGGGGAGGGGG + Intronic
999322688 5:150624982-150625004 CGGCGCCGCCCAGGAGGAGGTGG + Intronic
999767974 5:154755410-154755432 CCGGGCCGCCCCGGGGGCGGGGG + Intronic
1002521806 5:179796443-179796465 GCGCCCCTCCCCGGGGCAGCTGG - Exonic
1002645262 5:180649614-180649636 CCGCCCCGCCCCAGGCCAGCCGG - Exonic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1003324966 6:5084668-5084690 CCGCGCCGCCACTGGGCAGATGG + Exonic
1003545103 6:7052138-7052160 CCGCTCCGCCTCGGGGGAGGCGG + Intergenic
1005040366 6:21595272-21595294 CGGCGGCGCCCAGGGGCAGCAGG - Exonic
1006083594 6:31581255-31581277 CCGAGCCGGGCCGGGGGAGGAGG + Intronic
1006302279 6:33200074-33200096 CCGCCCCGCCCCGGGGGGGAGGG + Intronic
1006458548 6:34145133-34145155 CCGGCCTGCCCCGGGGGCGCAGG + Intronic
1007431516 6:41779904-41779926 CCGCCCCGCCCCGCGGCCGCGGG + Intronic
1010001778 6:70956252-70956274 CCGGGCCGCCCCTGCGGAGCGGG + Exonic
1010703400 6:79078103-79078125 CCCCGCCGCCGAGGGGAAGCGGG + Exonic
1012401413 6:98845242-98845264 CCGCCCCGCCCCGCGGGCCCCGG + Intergenic
1013472311 6:110476483-110476505 CCGCGGCGCCACGCGGGAGGCGG - Intronic
1014009711 6:116461904-116461926 GCGCGACGCCCCGGGGGACGAGG + Exonic
1017842386 6:158232332-158232354 CCGCGCAGTCCCGCGGGAGGGGG + Intronic
1018774213 6:166998864-166998886 CGGCGCCCCCCCGGGGCTGCAGG + Intergenic
1022375375 7:29806898-29806920 CCACGCCGCCCCGGCCGGGCCGG + Intronic
1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG + Intronic
1026522937 7:71132241-71132263 AGGCGCCTGCCCGGGGGAGCGGG + Exonic
1026968592 7:74454703-74454725 CCGCCCCGGCCCCGGGGAGGGGG + Intronic
1029366416 7:100119351-100119373 CCCCGCCCCCTCGTGGGAGCAGG + Intronic
1032083119 7:128869848-128869870 GGGCCCCGCACCGGGGGAGCAGG - Intronic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG + Intronic
1034224966 7:149474966-149474988 CCGCGGCGCCCCCCGGGGGCCGG - Exonic
1034227782 7:149497048-149497070 CCGCGCCGACCCCGGGAAGCTGG + Intronic
1034242957 7:149624096-149624118 CCGCGCCGACCCTGGGGAGCTGG + Intergenic
1035266309 7:157691941-157691963 GCGCGGCGCCCCCGCGGAGCTGG + Intronic
1037273746 8:17156547-17156569 CCGCGCCGGCTCGGGGCTGCGGG + Exonic
1038304035 8:26383286-26383308 CCGCGCCGCGCCGGTGGCGGCGG - Intronic
1038883580 8:31640003-31640025 CCGCGCCGCTCCGGGCGTCCCGG + Intronic
1039936566 8:42051577-42051599 CGGGCCCGCCCTGGGGGAGCCGG - Intronic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1041689889 8:60678665-60678687 CGGCGCGGCCCGGAGGGAGCTGG + Intergenic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1045510075 8:102806897-102806919 CCGCGCGGCCCGGGGGGCGGGGG + Intergenic
1046080236 8:109362466-109362488 CCGCTTCGTCCCGGGAGAGCTGG - Exonic
1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG + Intergenic
1047566107 8:126046379-126046401 CTGCTCCGCCCCAGGGTAGCAGG + Intergenic
1049531970 8:143159516-143159538 CCGAGGCGCCGCGGGAGAGCCGG - Intronic
1049583063 8:143421464-143421486 CCCCGCCCGGCCGGGGGAGCAGG + Intronic
1049792356 8:144477950-144477972 CCGCGGTGCCCCGTGGGAGCCGG - Intronic
1053003449 9:34590196-34590218 CCCAGCCGCCCTAGGGGAGCGGG - Intergenic
1055321671 9:75088488-75088510 CCGCCCCGCCCCGCGGCCGCCGG - Intergenic
1057773282 9:97984832-97984854 CCGCCCCGCGCCGGGCGCGCGGG + Intronic
1057921734 9:99104236-99104258 CCCCTCCGCCCCGCGGGAGCTGG + Intronic
1058885954 9:109321057-109321079 CGGCGCAGCCCCGAGGGAGGAGG - Intergenic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1060482137 9:124022835-124022857 CAGCGCTGCCCACGGGGAGCGGG + Intronic
1060849243 9:126860834-126860856 CCGCCGCGCCCAGAGGGAGCCGG - Intronic
1061293597 9:129665841-129665863 GCGAGCGGCCCCGGGGGGGCCGG - Exonic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1062084457 9:134641646-134641668 CCGCGGCGCCCAGTGGGAGGCGG + Intergenic
1062170967 9:135134391-135134413 GCGCCTCGCCCCTGGGGAGCAGG + Intergenic
1203470363 Un_GL000220v1:113186-113208 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203478184 Un_GL000220v1:157158-157180 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1185458643 X:323317-323339 CCGCGCTGCCCCGGCGAATCTGG - Intergenic
1185471540 X:386732-386754 CCGCCCCGCCCCGGGGGCTTCGG + Intronic
1185874486 X:3691421-3691443 TCCCCCCGCCCCGGGGGAGTGGG + Intronic
1187067377 X:15854486-15854508 CCGCGCCGCGCCCGGGGATGTGG - Intronic
1187859446 X:23667402-23667424 CCGCCCCGCCACGTGGGCGCCGG - Intronic
1189272965 X:39764683-39764705 CTGAGCCGCCCTGGGGGAGGGGG - Intergenic
1189324623 X:40105178-40105200 CCGCCCCTCCCCGTGGGGGCTGG + Intronic
1190118121 X:47638958-47638980 CAGCGCCCCCCTCGGGGAGCAGG - Exonic
1192533660 X:71910868-71910890 GTGTGCAGCCCCGGGGGAGCCGG + Intergenic
1192544839 X:72004721-72004743 CCGCTCCGGCCCAGGAGAGCTGG + Intergenic
1197766045 X:130060172-130060194 CCGCGCCGGTCCTTGGGAGCCGG + Intergenic
1199772578 X:150983990-150984012 CCGCGCCCCCCCGGGCCACCGGG - Intronic
1200051357 X:153433492-153433514 CCTCTCCGCCCCAGGGGACCTGG + Intergenic
1200147549 X:153934564-153934586 CTGCCCAGCCCCGAGGGAGCGGG - Intronic