ID: 1136117813

View in Genome Browser
Species Human (GRCh38)
Location 16:28106349-28106371
Sequence ATCTGAAAACTATAGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136117806_1136117813 -4 Left 1136117806 16:28106330-28106352 CCCACCACTTCTCCCTTGAATCT 0: 1
1: 0
2: 0
3: 27
4: 267
Right 1136117813 16:28106349-28106371 ATCTGAAAACTATAGATGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 188
1136117807_1136117813 -5 Left 1136117807 16:28106331-28106353 CCACCACTTCTCCCTTGAATCTG 0: 1
1: 0
2: 3
3: 37
4: 328
Right 1136117813 16:28106349-28106371 ATCTGAAAACTATAGATGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 188
1136117808_1136117813 -8 Left 1136117808 16:28106334-28106356 CCACTTCTCCCTTGAATCTGAAA 0: 1
1: 0
2: 5
3: 27
4: 298
Right 1136117813 16:28106349-28106371 ATCTGAAAACTATAGATGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 188
1136117804_1136117813 14 Left 1136117804 16:28106312-28106334 CCACACTTTGTCGCCAGACCCAC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1136117813 16:28106349-28106371 ATCTGAAAACTATAGATGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 188
1136117805_1136117813 1 Left 1136117805 16:28106325-28106347 CCAGACCCACCACTTCTCCCTTG 0: 1
1: 0
2: 0
3: 26
4: 333
Right 1136117813 16:28106349-28106371 ATCTGAAAACTATAGATGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136117813 Original CRISPR ATCTGAAAACTATAGATGGT GGG Intronic
902403168 1:16168958-16168980 ATGAGAAAACTAAAGCTGGTAGG + Intergenic
905911046 1:41654904-41654926 ACCTGAGAACTATAGATGTGGGG - Intronic
908027294 1:59966426-59966448 ATCTGTAAACTGGAAATGGTAGG - Intergenic
909574343 1:77157317-77157339 ATCTTAAAAATAAAGGTGGTAGG + Intronic
909636143 1:77819149-77819171 ATCTGAAAAATAGGGATGATAGG - Intronic
911050952 1:93670763-93670785 ATCTGAAAACTATAAAATGTAGG + Intronic
911592122 1:99760627-99760649 ATCTGACAACTTAAGATGGTAGG + Intronic
912583594 1:110741530-110741552 ATCTGGAAACTTAAGATGCTAGG - Intergenic
913580178 1:120218894-120218916 CTCTGAAGACTATACATAGTAGG - Intergenic
913627998 1:120679499-120679521 CTCTGAAGACTATACATAGTAGG + Intergenic
914562103 1:148830335-148830357 CTCTGAAGACTATACATAGTAGG - Intronic
914610727 1:149299886-149299908 CTCTGAAGACTATACATAGTAGG + Intergenic
917249677 1:173044437-173044459 ATCTGAATATTATACATGGGTGG - Intronic
918599921 1:186345420-186345442 AATTGAAAAGTATAGATGGAAGG - Intronic
919537385 1:198805125-198805147 ATCTGATAACTAAAGAGAGTTGG + Intergenic
921485095 1:215705699-215705721 ACCAGAAAACTAAAGATGGTAGG + Intronic
921539031 1:216390144-216390166 ATCTTAAAACCATAGATTCTAGG + Intronic
924006201 1:239614342-239614364 TTCTGAAAAATACAGAAGGTAGG + Intronic
1064118176 10:12596603-12596625 ATCTGAAACCTGTAGATGAGAGG + Intronic
1064595484 10:16940646-16940668 ATGTAAGCACTATAGATGGTGGG + Intronic
1065466699 10:26032220-26032242 GCCTGAAAACCATAGATGCTGGG - Intronic
1072680440 10:97502159-97502181 ATATGAAAAATGCAGATGGTAGG - Intronic
1073714176 10:106083572-106083594 ATCTGTAAAATTTAAATGGTTGG - Intergenic
1073761952 10:106638869-106638891 ACCTGTAAATTAAAGATGGTAGG + Intronic
1077790167 11:5430711-5430733 GTCTTAACACTATAGATGATGGG + Intronic
1079190706 11:18274658-18274680 ACCTGAAAACTATAGATCAAGGG - Intergenic
1080049090 11:27840306-27840328 ATCTGCAAACTATGGTTTGTAGG + Intergenic
1082830490 11:57613398-57613420 ATCTCCAAATTATAGCTGGTTGG - Intronic
1083845709 11:65332036-65332058 AACTGAAAGCTATTGATGCTGGG - Intergenic
1084871682 11:72102907-72102929 ATCTGAAAAGTTTTGAAGGTAGG + Intronic
1088438820 11:109845603-109845625 ATCTGAAAACTATCAAGGCTAGG + Intergenic
1088996249 11:115000180-115000202 ATTTTAAAACTCTGGATGGTGGG + Intergenic
1089095853 11:115919465-115919487 ATATGAAAACTAGAGAAGGAAGG - Intergenic
1089108867 11:116038171-116038193 CTCTGAAAACCACAGTTGGTGGG + Intergenic
1090225862 11:125071903-125071925 ATCTGAAAAGGATAGAGGGCTGG - Intronic
1091860044 12:3773080-3773102 ATGTGAGAAATATAGATGGAAGG + Intergenic
1091864571 12:3820250-3820272 ATTTGAAAACTATTGCTGGATGG + Intronic
1093448549 12:19288725-19288747 ATCTTAAAACATTAGATTGTTGG + Intronic
1093519812 12:20035549-20035571 CTTTGAAAACTAAAGATGGGAGG - Intergenic
1095600416 12:44006646-44006668 ATCTGAAGAATTTAGATGGCTGG + Intronic
1098197346 12:68015927-68015949 ATCTGAAAACTAGAGACGGGGGG + Intergenic
1100065978 12:90645674-90645696 TTCTAAAAAGTATAGTTGGTTGG - Intergenic
1100684448 12:96971386-96971408 CTCTGAAAACTAGAGCTAGTGGG - Intergenic
1101554212 12:105792483-105792505 ATCAGCAAAATATAGATAGTGGG + Intergenic
1105687165 13:22795427-22795449 ATCTCAAAACAATAGTTTGTGGG + Intergenic
1108089483 13:46832786-46832808 ATTTGAAAACTAAAGAATGTGGG - Exonic
1111737985 13:92165831-92165853 ATCTTAAAACTCTATATGATAGG + Intronic
1112703774 13:102042832-102042854 CTCTCAAAACTATGGATAGTTGG + Intronic
1112722825 13:102264658-102264680 ATCTGGGAGCTAAAGATGGTGGG + Intronic
1115420502 14:33188845-33188867 AACTGAAAAATATAGATATTTGG + Intronic
1115486744 14:33917735-33917757 ATCTGGAAACTCCAGATAGTTGG + Intergenic
1117031987 14:51682234-51682256 AGCTGAAAAATTTAGGTGGTTGG - Intronic
1119614268 14:76088449-76088471 ATCTGCAAAATACAGATGGGAGG + Intergenic
1121116011 14:91343302-91343324 ATCTGCAAACTACAGCTTGTGGG - Intronic
1124943761 15:34243716-34243738 ACCTGAAAATTATAGAAGGCTGG + Intronic
1125406760 15:39360473-39360495 ACCTAAAAACTATAGAAGGATGG + Intergenic
1126017879 15:44370607-44370629 ATCTGAATACCGAAGATGGTTGG + Intronic
1129134127 15:73531282-73531304 ATCTGAAGTCCAAAGATGGTGGG - Intronic
1130634771 15:85607199-85607221 ATCTGATAACTGGAGAAGGTAGG - Intronic
1131224132 15:90609916-90609938 ATCTGACAACCATGGAGGGTGGG + Intronic
1134537514 16:15038209-15038231 TTCTGAAAACACAAGATGGTGGG + Exonic
1136117813 16:28106349-28106371 ATCTGAAAACTATAGATGGTGGG + Intronic
1137288603 16:47036772-47036794 ATCTGACAACTCTAGCTGGGTGG - Intergenic
1138021564 16:53487006-53487028 TCCTGAAAACTATAGAAGCTTGG + Intronic
1138633043 16:58314750-58314772 TTCTGAAGACTAGAGATGATTGG + Intronic
1138897437 16:61224711-61224733 ATTTGAAAACTATAGATTTTTGG + Intergenic
1140608001 16:76564078-76564100 ATCAGAAAACTATGGCTTGTAGG - Intronic
1142862744 17:2773163-2773185 GTCCGCAAACTATAGATGGGTGG + Intergenic
1144402038 17:14914836-14914858 ATCAGAAAACTACAGATAGAAGG + Intergenic
1144813042 17:18013846-18013868 ATCTGATCACTATACATGATAGG + Intronic
1146584820 17:34073354-34073376 ATCAGCAAACTATAGCTTGTGGG - Intronic
1148394354 17:47296181-47296203 ATCTGGAAAGTAGAGATGTTGGG - Intronic
1153709634 18:7784616-7784638 ATCTGAAGAATATAGAAGGTTGG - Intronic
1153967436 18:10194750-10194772 ATCTGAAAGCTTTAGAGGGGAGG - Intergenic
1155723381 18:29048099-29048121 ATCTGAAAACAATAACTGTTGGG + Intergenic
1156162651 18:34378215-34378237 ATGTGAAGACTAGAGATGGGAGG - Intergenic
1159456998 18:68671408-68671430 ATGTGAAAAATTTAGATGGGTGG + Intergenic
1162616160 19:11802114-11802136 ATTTGAAAACCATCGATGGCTGG - Intronic
1164871059 19:31643451-31643473 ATGTGAAATCTATAGATCGAGGG + Intergenic
1165702818 19:37951455-37951477 ATCTAAAAATTTTAGTTGGTAGG + Intronic
1166631604 19:44411981-44412003 AGCTGAAATCTGGAGATGGTTGG - Intergenic
1166636572 19:44456640-44456662 AGCTGAAATCTGGAGATGGTTGG + Intergenic
1166940316 19:46359274-46359296 TTCTGAAGACTAGAGATGATTGG - Intronic
1167091848 19:47349638-47349660 AGCTGAAAACTAGAGAGCGTGGG + Intronic
926377472 2:12248077-12248099 ATCTGTAAGTTAAAGATGGTTGG - Intergenic
930723145 2:54657217-54657239 ATGGGAACACTACAGATGGTGGG - Intronic
931324296 2:61202342-61202364 CTCTGAAAACTATAGAACATTGG + Intronic
931912881 2:66921447-66921469 ATCTGTGAACTAGATATGGTTGG + Intergenic
933004508 2:76973494-76973516 ATCTGAAAACTTTAGACAATGGG - Intronic
934549564 2:95248303-95248325 AGATGAAAACAATAGATGTTGGG + Intronic
935698494 2:105790293-105790315 ATCTGCTAAAAATAGATGGTGGG - Intronic
937754627 2:125521758-125521780 ATCAGAAAATAATAGATGTTTGG + Intergenic
942237325 2:173924091-173924113 ATTTTAAAAATATAGATGGATGG + Intronic
942808598 2:179967850-179967872 ATCTAACAACTATAGTTAGTTGG - Intronic
945312429 2:208330134-208330156 ATCCGAAAAATGTTGATGGTAGG - Intronic
1169200005 20:3704341-3704363 AGCAGAAAACTACAGCTGGTGGG - Intronic
1170345582 20:15383065-15383087 ATCTGAAAATTCCAGAAGGTAGG + Intronic
1173682757 20:44897740-44897762 ATCTTAAAAGTATATATAGTTGG - Intronic
1176938393 21:14894043-14894065 ATTTGATAAGTTTAGATGGTAGG - Intergenic
1177901341 21:26919814-26919836 AACCTAAAACTATAGATTGTTGG + Exonic
1177955563 21:27594179-27594201 ATCTGAAAACTAGAAAGGATAGG + Intergenic
1182962866 22:34492519-34492541 ATCTGAAAACTAGTGGTGCTGGG + Intergenic
1183625101 22:38997071-38997093 ATCTGATCACTCTACATGGTAGG - Intergenic
1183682416 22:39340634-39340656 AGCTGAAAACTTTAAATGCTAGG - Intergenic
950114099 3:10439277-10439299 ATCTGGAAAATAAAGAAGGTTGG - Intronic
950118566 3:10467039-10467061 ACCTGAAAACTAAAGAGGTTGGG + Intronic
952129538 3:30344656-30344678 ATCTAATAAACATAGATGGTAGG - Intergenic
952165818 3:30747400-30747422 ATCTGAATACTAGAGAAGGAAGG + Intronic
952868113 3:37871552-37871574 TTCTGAAAGCTAAAGATGGTAGG - Intronic
956886522 3:73565483-73565505 ATCTGAAAAGGAGAGAAGGTTGG + Intronic
957267875 3:77990361-77990383 TTCTGAAAAATAGAGAAGGTGGG - Intergenic
959148131 3:102574427-102574449 ATCTGAAAAGTACAGGTGCTAGG - Intergenic
961399710 3:126630083-126630105 ATGGGAAAACTATAGACTGTGGG + Intronic
962446682 3:135472166-135472188 ATCCCTAAACTATAGAGGGTGGG + Intergenic
962541481 3:136386899-136386921 ATCTGACAAATATAGATTTTTGG + Intronic
962703697 3:138023396-138023418 ATCAGAGAATTATGGATGGTTGG - Intronic
963212255 3:142706366-142706388 ATTTGAACATCATAGATGGTGGG + Intronic
969519875 4:7670246-7670268 CTGTGAAAACTATAAAGGGTGGG + Intronic
973818299 4:54639432-54639454 ATCTGTAAAATAAAGAAGGTGGG + Intergenic
974225408 4:59036602-59036624 ATATAAAAATTAAAGATGGTAGG - Intergenic
974777488 4:66505365-66505387 ATCAGAAAACTATAGTTGCAGGG + Intergenic
975959169 4:79879956-79879978 ATCTGGAAAATATAGATGTGAGG + Intergenic
976335117 4:83876721-83876743 TTCTGAAAACAATAATTGGTTGG - Intergenic
977374482 4:96184173-96184195 ACAAGAAAACTATAGCTGGTAGG + Intergenic
977870600 4:102085728-102085750 ATATGACAACTATAGAGGCTGGG - Intergenic
978041969 4:104077471-104077493 ATCAAAAAATAATAGATGGTTGG + Intergenic
978740322 4:112130610-112130632 ATCTGAAAACTATACACCTTAGG + Intergenic
981536392 4:145804592-145804614 ATCTGAAGATTATTGAAGGTAGG + Intronic
981740181 4:147992869-147992891 ATCGCAAAACAATAGATGATGGG - Intronic
981760964 4:148193698-148193720 ATATGAAACCCATAGATAGTGGG + Intronic
982364913 4:154566965-154566987 ATGTTAAAACTATAAATGCTAGG - Intronic
983744090 4:171172978-171173000 ATTTGCAAACTATATATGATAGG - Intergenic
989949205 5:50277047-50277069 AAATGAAAACAATAGATAGTGGG + Intergenic
992066743 5:73116524-73116546 ATCTGAAAACTGCACTTGGTTGG + Intergenic
992484820 5:77184405-77184427 GTCTATAAACTATGGATGGTAGG + Intergenic
992972310 5:82074311-82074333 ATGTGAAAACTTGGGATGGTGGG + Intronic
993041229 5:82817017-82817039 CTCTGAAAACTACAGCTGGGGGG - Intergenic
994482821 5:100357704-100357726 GTCTGAAATCTATAGCTGTTTGG - Intergenic
994727938 5:103458547-103458569 ATCTGAAAATTATAGTTGTCAGG + Intergenic
995040990 5:107587815-107587837 ATATTAAAACTATAGGTGGCAGG - Intronic
995682195 5:114732177-114732199 ATTTAAAAACCATAGATGCTGGG - Intergenic
996054315 5:118966474-118966496 ATCTAAAAACCACAGATTGTTGG - Intronic
996362827 5:122669453-122669475 GACTAAAAACTTTAGATGGTTGG - Intergenic
996643048 5:125780524-125780546 ATCTAAAAACTATACATAATTGG - Intergenic
997170229 5:131711790-131711812 ATTTGAAAACTACAGTTGGCTGG - Intronic
999656055 5:153811679-153811701 ATCTGAAAACTGAAGAGGGGTGG - Exonic
1001370192 5:171192208-171192230 ATCTGAAAAATAGACATGGGGGG + Intronic
1004408451 6:15357701-15357723 ATCTTTAAACTGTAGATGGTGGG + Intronic
1005390054 6:25323839-25323861 ATGTGAAAACTATAGTTGAAAGG - Intronic
1008293404 6:49747168-49747190 ATCAGTAAACTATAGGTAGTTGG - Intergenic
1008764704 6:54897518-54897540 ATCTGAAAACTGCAGATGTCTGG + Intronic
1011617170 6:89207758-89207780 ATTTGAAAACTATTGCTGGCTGG - Intronic
1013377479 6:109531850-109531872 ATCTGAGAACTATGGATGTGAGG - Intronic
1013506581 6:110806398-110806420 ATCTGAAGACTGGAGATGGGGGG - Intronic
1013606287 6:111751958-111751980 ATCTGAGAAAAATACATGGTAGG - Intronic
1016381562 6:143488370-143488392 TTTTGAAAACTATATATGATTGG - Intronic
1017390072 6:153928243-153928265 ATGGGAAAACTAGAGAAGGTTGG + Intergenic
1017476619 6:154800466-154800488 CTGTGAAAACTATAAATGGTGGG + Intronic
1019447833 7:1080679-1080701 ATCTGAAAACTACAGGTTCTCGG + Intronic
1020549679 7:9586846-9586868 ATCTGAAAAGTATAAATAATTGG + Intergenic
1020844380 7:13264019-13264041 ATCTGAAAAGTATGGATTCTAGG - Intergenic
1021059550 7:16093670-16093692 ATCAAAAAACTATATATGTTTGG + Intronic
1022250282 7:28600502-28600524 ATGTGAAAACTGAGGATGGTAGG + Intronic
1024801277 7:53082957-53082979 ACCTGGAAACCATAGCTGGTGGG - Intergenic
1026132016 7:67628766-67628788 ATCTGAACACTTTAAATGGGTGG + Intergenic
1026237677 7:68542367-68542389 ATCTAAAAGGAATAGATGGTGGG + Intergenic
1027568815 7:79835178-79835200 ATCTGCCAAATATAGATTGTGGG + Intergenic
1028909057 7:96187598-96187620 CTCTGAAAATTATAGAGGGTGGG + Intronic
1032847064 7:135760210-135760232 ATCTGAATACAATGGGTGGTAGG + Intergenic
1035391627 7:158508265-158508287 ATCCGAAAGCTTTCGATGGTCGG + Intronic
1035890867 8:3341221-3341243 GTATGGAAACTATAGGTGGTCGG - Intronic
1037276403 8:17184459-17184481 ATCTGAACTCTATAGTTGGAAGG + Intronic
1039940788 8:42088998-42089020 AATTGTAAAATATAGATGGTGGG + Intergenic
1040446761 8:47503722-47503744 TTGTAAAGACTATAGATGGTAGG - Intronic
1040746396 8:50647768-50647790 ATCTTAAAATGATAGATGTTTGG + Intronic
1041386230 8:57306634-57306656 ATCTGAAAAGTTTAAATGTTTGG + Intergenic
1043118821 8:76295425-76295447 ATCTGCAAACTCTAGACTGTGGG - Intergenic
1044246917 8:89959204-89959226 TTCTGATTTCTATAGATGGTAGG - Intronic
1044754882 8:95451119-95451141 ATCTGACTACTATTGATGGAAGG - Intergenic
1046652332 8:116850552-116850574 ATATGAAAAATAAAGCTGGTTGG + Intronic
1047614347 8:126550962-126550984 ACCTGTAAAGTATGGATGGTTGG - Intergenic
1048379089 8:133848034-133848056 ATCTGGAATGTATAGATGATGGG - Intergenic
1050486982 9:6144983-6145005 AACTGAAAACTATTGAAGATGGG - Intergenic
1052325167 9:27209657-27209679 ATATGAAAACTAAGGATGGTTGG + Intronic
1054754113 9:68939725-68939747 ATGTGAAGGGTATAGATGGTGGG - Intronic
1057289854 9:93798618-93798640 TTCTGAAAACTAAAGATAGAGGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059885462 9:118740302-118740324 ATTTGAAAAATAAAGATGTTGGG - Intergenic
1185993445 X:4916782-4916804 GTCTGCAAACCATAGCTGGTGGG + Intergenic
1187985032 X:24801062-24801084 ATCTGGAAACTATAGTTGTATGG + Intronic
1188630838 X:32358082-32358104 ATCGGAAAATAATATATGGTTGG + Intronic
1189136219 X:38552927-38552949 ATCTGAAAAATGTAGTTTGTGGG + Intronic
1191656746 X:63606939-63606961 ATCAGATAACTATAGATGTATGG - Intergenic
1191822330 X:65324868-65324890 ATCTGATAATTATAGAAAGTAGG + Intergenic
1193185365 X:78505928-78505950 TTCTGAAAACTATAGGAGGAGGG + Intergenic
1195577722 X:106469019-106469041 ATCAGAACACTATAGTTTGTTGG - Intergenic
1195793838 X:108621705-108621727 ACCAGAAAACTATTGAGGGTTGG - Intronic
1198196418 X:134367295-134367317 ATCTGTAAACTAAGGATGCTAGG - Intergenic
1198406673 X:136319836-136319858 ATCAGAAAAATAAAGATGGATGG - Intronic
1199543127 X:148979677-148979699 CCCTGTAAACTATAGAGGGTAGG - Intronic