ID: 1136118486

View in Genome Browser
Species Human (GRCh38)
Location 16:28112067-28112089
Sequence CGGGTGCTGAAGGCTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118486_1136118493 9 Left 1136118486 16:28112067-28112089 CCCAACACAGCCTTCAGCACCCG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257
1136118486_1136118490 -7 Left 1136118486 16:28112067-28112089 CCCAACACAGCCTTCAGCACCCG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1136118490 16:28112083-28112105 GCACCCGCTGGCTGCACACCTGG 0: 1
1: 0
2: 0
3: 19
4: 152
1136118486_1136118502 29 Left 1136118486 16:28112067-28112089 CCCAACACAGCCTTCAGCACCCG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118486_1136118501 28 Left 1136118486 16:28112067-28112089 CCCAACACAGCCTTCAGCACCCG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1136118501 16:28112118-28112140 CAGGCTCGTTTCTTGCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118486 Original CRISPR CGGGTGCTGAAGGCTGTGTT GGG (reversed) Intronic