ID: 1136118487

View in Genome Browser
Species Human (GRCh38)
Location 16:28112068-28112090
Sequence GCGGGTGCTGAAGGCTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118487_1136118502 28 Left 1136118487 16:28112068-28112090 CCAACACAGCCTTCAGCACCCGC 0: 1
1: 0
2: 0
3: 32
4: 359
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118487_1136118490 -8 Left 1136118487 16:28112068-28112090 CCAACACAGCCTTCAGCACCCGC 0: 1
1: 0
2: 0
3: 32
4: 359
Right 1136118490 16:28112083-28112105 GCACCCGCTGGCTGCACACCTGG 0: 1
1: 0
2: 0
3: 19
4: 152
1136118487_1136118501 27 Left 1136118487 16:28112068-28112090 CCAACACAGCCTTCAGCACCCGC 0: 1
1: 0
2: 0
3: 32
4: 359
Right 1136118501 16:28112118-28112140 CAGGCTCGTTTCTTGCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1136118487_1136118493 8 Left 1136118487 16:28112068-28112090 CCAACACAGCCTTCAGCACCCGC 0: 1
1: 0
2: 0
3: 32
4: 359
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118487 Original CRISPR GCGGGTGCTGAAGGCTGTGT TGG (reversed) Intronic