ID: 1136118489

View in Genome Browser
Species Human (GRCh38)
Location 16:28112077-28112099
Sequence GTGCAGCCAGCGGGTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118489_1136118501 18 Left 1136118489 16:28112077-28112099 CCTTCAGCACCCGCTGGCTGCAC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1136118501 16:28112118-28112140 CAGGCTCGTTTCTTGCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1136118489_1136118493 -1 Left 1136118489 16:28112077-28112099 CCTTCAGCACCCGCTGGCTGCAC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257
1136118489_1136118502 19 Left 1136118489 16:28112077-28112099 CCTTCAGCACCCGCTGGCTGCAC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118489_1136118503 24 Left 1136118489 16:28112077-28112099 CCTTCAGCACCCGCTGGCTGCAC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118489 Original CRISPR GTGCAGCCAGCGGGTGCTGA AGG (reversed) Intronic