ID: 1136118492

View in Genome Browser
Species Human (GRCh38)
Location 16:28112087-28112109
Sequence GGTTCCAGGTGTGCAGCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118492_1136118504 21 Left 1136118492 16:28112087-28112109 CCGCTGGCTGCACACCTGGAACC 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136118504 16:28112131-28112153 TGCAACCTGGGCAAGGCCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 173
1136118492_1136118502 9 Left 1136118492 16:28112087-28112109 CCGCTGGCTGCACACCTGGAACC 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118492_1136118506 30 Left 1136118492 16:28112087-28112109 CCGCTGGCTGCACACCTGGAACC 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136118506 16:28112140-28112162 GGCAAGGCCTTTGGTCCAACTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1136118492_1136118501 8 Left 1136118492 16:28112087-28112109 CCGCTGGCTGCACACCTGGAACC 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136118501 16:28112118-28112140 CAGGCTCGTTTCTTGCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1136118492_1136118503 14 Left 1136118492 16:28112087-28112109 CCGCTGGCTGCACACCTGGAACC 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118492 Original CRISPR GGTTCCAGGTGTGCAGCCAG CGG (reversed) Intronic