ID: 1136118493

View in Genome Browser
Species Human (GRCh38)
Location 16:28112099-28112121
Sequence CACCTGGAACCCTAGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1312
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 1257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118486_1136118493 9 Left 1136118486 16:28112067-28112089 CCCAACACAGCCTTCAGCACCCG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257
1136118491_1136118493 -10 Left 1136118491 16:28112086-28112108 CCCGCTGGCTGCACACCTGGAAC 0: 1
1: 1
2: 0
3: 21
4: 207
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257
1136118487_1136118493 8 Left 1136118487 16:28112068-28112090 CCAACACAGCCTTCAGCACCCGC 0: 1
1: 0
2: 0
3: 32
4: 359
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257
1136118485_1136118493 24 Left 1136118485 16:28112052-28112074 CCGTGGTGCGGCATGCCCAACAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257
1136118489_1136118493 -1 Left 1136118489 16:28112077-28112099 CCTTCAGCACCCGCTGGCTGCAC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1136118493 16:28112099-28112121 CACCTGGAACCCTAGCCCCCAGG 0: 1
1: 0
2: 1
3: 53
4: 1257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118493 Original CRISPR CACCTGGAACCCTAGCCCCC AGG Intronic