ID: 1136118494

View in Genome Browser
Species Human (GRCh38)
Location 16:28112101-28112123
Sequence AGCCTGGGGGCTAGGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 290}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118494_1136118502 -5 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118494_1136118509 29 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118509 16:28112153-28112175 GTCCAACTGGAAGGCAACTTAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1136118494_1136118510 30 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118510 16:28112154-28112176 TCCAACTGGAAGGCAACTTAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
1136118494_1136118501 -6 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118501 16:28112118-28112140 CAGGCTCGTTTCTTGCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1136118494_1136118506 16 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118506 16:28112140-28112162 GGCAAGGCCTTTGGTCCAACTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1136118494_1136118503 0 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1136118494_1136118504 7 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118504 16:28112131-28112153 TGCAACCTGGGCAAGGCCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 173
1136118494_1136118507 20 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118507 16:28112144-28112166 AGGCCTTTGGTCCAACTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118494 Original CRISPR AGCCTGGGGGCTAGGGTTCC AGG (reversed) Intronic