ID: 1136118502

View in Genome Browser
Species Human (GRCh38)
Location 16:28112119-28112141
Sequence AGGCTCGTTTCTTGCAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118487_1136118502 28 Left 1136118487 16:28112068-28112090 CCAACACAGCCTTCAGCACCCGC 0: 1
1: 0
2: 0
3: 32
4: 359
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118494_1136118502 -5 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118492_1136118502 9 Left 1136118492 16:28112087-28112109 CCGCTGGCTGCACACCTGGAACC 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118491_1136118502 10 Left 1136118491 16:28112086-28112108 CCCGCTGGCTGCACACCTGGAAC 0: 1
1: 1
2: 0
3: 21
4: 207
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118486_1136118502 29 Left 1136118486 16:28112067-28112089 CCCAACACAGCCTTCAGCACCCG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1136118489_1136118502 19 Left 1136118489 16:28112077-28112099 CCTTCAGCACCCGCTGGCTGCAC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1136118502 16:28112119-28112141 AGGCTCGTTTCTTGCAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118502 Original CRISPR AGGCTCGTTTCTTGCAACCT GGG Intronic