ID: 1136118503

View in Genome Browser
Species Human (GRCh38)
Location 16:28112124-28112146
Sequence CGTTTCTTGCAACCTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136118494_1136118503 0 Left 1136118494 16:28112101-28112123 CCTGGAACCCTAGCCCCCAGGCT 0: 1
1: 0
2: 1
3: 42
4: 290
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1136118491_1136118503 15 Left 1136118491 16:28112086-28112108 CCCGCTGGCTGCACACCTGGAAC 0: 1
1: 1
2: 0
3: 21
4: 207
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1136118496_1136118503 -8 Left 1136118496 16:28112109-28112131 CCTAGCCCCCAGGCTCGTTTCTT 0: 1
1: 0
2: 1
3: 21
4: 284
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1136118492_1136118503 14 Left 1136118492 16:28112087-28112109 CCGCTGGCTGCACACCTGGAACC 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1136118495_1136118503 -7 Left 1136118495 16:28112108-28112130 CCCTAGCCCCCAGGCTCGTTTCT 0: 1
1: 0
2: 1
3: 8
4: 196
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1136118489_1136118503 24 Left 1136118489 16:28112077-28112099 CCTTCAGCACCCGCTGGCTGCAC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1136118503 16:28112124-28112146 CGTTTCTTGCAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136118503 Original CRISPR CGTTTCTTGCAACCTGGGCA AGG Intronic