ID: 1136119699

View in Genome Browser
Species Human (GRCh38)
Location 16:28124452-28124474
Sequence CATTTGCACTGAGGTTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136119699_1136119709 12 Left 1136119699 16:28124452-28124474 CCTGCTAAACCTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1136119709 16:28124487-28124509 GAAGAGGAGGAGGAACGGACTGG 0: 1
1: 0
2: 15
3: 103
4: 1096
1136119699_1136119710 29 Left 1136119699 16:28124452-28124474 CCTGCTAAACCTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1136119710 16:28124504-28124526 GACTGGCAATACAAACGCTACGG 0: 1
1: 0
2: 1
3: 2
4: 55
1136119699_1136119703 -4 Left 1136119699 16:28124452-28124474 CCTGCTAAACCTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1136119703 16:28124471-28124493 AATGGGCCCAGTACAAGAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1136119699_1136119708 7 Left 1136119699 16:28124452-28124474 CCTGCTAAACCTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1136119708 16:28124482-28124504 TACAAGAAGAGGAGGAGGAACGG 0: 1
1: 0
2: 16
3: 168
4: 1307
1136119699_1136119704 -1 Left 1136119699 16:28124452-28124474 CCTGCTAAACCTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1136119704 16:28124474-28124496 GGGCCCAGTACAAGAAGAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 229
1136119699_1136119706 2 Left 1136119699 16:28124452-28124474 CCTGCTAAACCTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1136119706 16:28124477-28124499 CCCAGTACAAGAAGAGGAGGAGG 0: 1
1: 0
2: 4
3: 23
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136119699 Original CRISPR CATTTGCACTGAGGTTTAGC AGG (reversed) Intronic
904950793 1:34236975-34236997 CAAGGGCACTGAAGTTTAGCTGG + Intergenic
905480338 1:38257598-38257620 CATTGGCACTGAGACTTAGAGGG + Intergenic
905807101 1:40884858-40884880 CATCTGCACAGCAGTTTAGCAGG + Intergenic
907127086 1:52060367-52060389 TACTTGTACAGAGGTTTAGCTGG + Intronic
909595324 1:77399806-77399828 TATTTGCAAAGAGGTTTAGAAGG + Intronic
914327482 1:146634520-146634542 CATTTCCACTGAGGTATTGTGGG + Intergenic
916261637 1:162848145-162848167 CCTTTGAACTGGGGTTAAGCTGG + Intronic
916957884 1:169859203-169859225 CATTTGCTCCTAGGTTTTGCTGG - Exonic
919152179 1:193715413-193715435 CATATTCACTGAGTTTTAGAAGG + Intergenic
920231767 1:204475438-204475460 CATTTCCACTGAGCTTGAACTGG + Intronic
1067512051 10:46904316-46904338 CATATGCAGTGAGGGTCAGCTGG - Intergenic
1067650195 10:48147508-48147530 CATATGCAGTGAGGGTCAGCTGG + Intergenic
1070209994 10:74307097-74307119 CATTTCCACTGGGGTTTGGGGGG - Intronic
1072049014 10:91685036-91685058 CATTTGCACTGAGGTCTGGAGGG - Intergenic
1072087154 10:92091682-92091704 CATTTTCACTGAGCTTTTTCAGG - Intronic
1074043922 10:109819613-109819635 CATTTCCACTGAGGTATGCCTGG - Intergenic
1075722758 10:124597102-124597124 CCTTTGGACTCTGGTTTAGCTGG + Intronic
1076503498 10:130955984-130956006 CATTTTCATTGAGGATAAGCTGG - Intergenic
1079949925 11:26789150-26789172 CATTTGCACTGAAGGTATGCAGG - Intergenic
1080124646 11:28718832-28718854 CATTTGTATTGAGGGTTGGCTGG - Intergenic
1086836334 11:91628211-91628233 CAGTTGCAATGTGGTTTAGAAGG + Intergenic
1086900970 11:92367068-92367090 CTTCTGCACTGAGGTGAAGCAGG + Intronic
1088278028 11:108109609-108109631 TTTTTACACTGAGGTTTAACAGG - Intergenic
1088988282 11:114929045-114929067 CATTTGCACTCGGGTTTAACAGG - Intergenic
1089699652 11:120236846-120236868 CATGTGCCCTGAGGCTTAGAAGG - Intronic
1090892128 11:130933020-130933042 CATTTACGCTGAGCTTGAGCTGG + Intergenic
1095121870 12:38428778-38428800 GATTTGCGCTTAGGTTTACCTGG - Intergenic
1096514813 12:52149907-52149929 CAATTGCACAGAGGTTTTGCAGG + Intergenic
1098490279 12:71067909-71067931 CAATTGAACTGAGTTTGAGCTGG - Intronic
1104587159 12:130056661-130056683 CAGTTCAACTGAGGTTTAGAAGG + Intergenic
1104656549 12:130577817-130577839 CATTAGCTCTGAGGGTTGGCGGG - Intronic
1107442667 13:40442155-40442177 CATATGCTCTGAGTTTTATCAGG + Intergenic
1108258230 13:48630957-48630979 CATTTGCACTGAGAGTGAGCGGG + Intergenic
1110613549 13:77516079-77516101 CATTTGCACTCAGTTTCAGCAGG - Intergenic
1110768113 13:79303632-79303654 TTTTTGCACTGATGTTTATCAGG - Intergenic
1115976631 14:39004109-39004131 CATCGGCTCTGAGGATTAGCAGG - Intergenic
1129417807 15:75397553-75397575 CATGTACATTGATGTTTAGCAGG - Intronic
1134359264 16:13516153-13516175 CATTAGCTCTGTGGTTTATCTGG - Intergenic
1136119699 16:28124452-28124474 CATTTGCACTGAGGTTTAGCAGG - Intronic
1138783567 16:59818277-59818299 TTTTTGCACCGAGGTTTACCAGG - Intergenic
1139078664 16:63486697-63486719 CATTTCCACTGAGGTTCACAAGG + Intergenic
1140006079 16:71076420-71076442 CATTTCCACTGAGGTATTGTGGG - Intronic
1142429944 16:90020485-90020507 CATTTGCTCTGGGATTTTGCAGG + Intronic
1146693614 17:34892997-34893019 CAGTTGCACTGAGGGTGAGGTGG - Intergenic
1147417820 17:40306430-40306452 CTTTTGCACAGAGGTGGAGCAGG + Intergenic
1153389139 18:4534567-4534589 CTATTGTACTGAGGTTGAGCTGG + Intergenic
1155070753 18:22313894-22313916 CATTTGCACTGAGGTGTAAATGG + Intergenic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1158827580 18:61240774-61240796 CATTGGCACTGATGTTTTCCTGG - Intergenic
925004636 2:432055-432077 CATTTGGACTCTGGTTCAGCAGG + Intergenic
925904552 2:8532354-8532376 ACTTTGCACTGGGGTGTAGCAGG - Intergenic
932817613 2:74874390-74874412 CATTCGCACTGAGTTTGACCAGG + Exonic
932893246 2:75613724-75613746 CATTTGAGCTGAGCTTTACCAGG - Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
935864651 2:107373765-107373787 CATTTGCACGCAGGTTTATATGG - Intergenic
937663840 2:124462184-124462206 CATTTGACCAGAGGTTTATCTGG + Intronic
938232418 2:129672658-129672680 CATTTGCATTGAGATGTAGCGGG - Intergenic
942545342 2:177057547-177057569 CATTTTCACTGAAGGTTTGCAGG - Intergenic
946769941 2:223078142-223078164 CATTTTCACTGAGGCTAGGCAGG - Intronic
947316997 2:228870833-228870855 CAATTCCACTGAAGTTTAGTTGG - Intronic
948607043 2:239142480-239142502 CATTTGCACTGGGACTTGGCGGG - Intronic
1168846606 20:949530-949552 CATTTGAACTGAGATGTAGAGGG + Intergenic
1168846622 20:949633-949655 CATTTGAACTGAGATGTAGAGGG + Intergenic
1170329334 20:15191153-15191175 CATTTCCACTGAGGTTCCTCTGG + Intronic
1172600645 20:36180338-36180360 CAGGTGCACTGAGGTTTGGGAGG - Intronic
1174273377 20:49385560-49385582 CATTGTCACAGAGTTTTAGCTGG + Intronic
1174589913 20:51636719-51636741 CATTAGGACTGATGTTTGGCAGG - Intronic
1176155890 20:63620263-63620285 CATTATCACTGGGTTTTAGCAGG - Intronic
1178606176 21:34037855-34037877 CATTTGCACTGGTGTTTGGCAGG + Intergenic
1179126297 21:38594191-38594213 CATTTCCACTGAGTTTTGACTGG + Intronic
951976104 3:28510888-28510910 CATGTCCACTGAGGATTAGTAGG + Intronic
953250022 3:41236800-41236822 CATTTGCATTGATGTTTCCCTGG + Intronic
953908536 3:46880889-46880911 GATTTGCACTGAGGGTTGGAGGG + Intronic
955659153 3:61278028-61278050 CCTATGCACTGAAGTTTAGCTGG + Intergenic
958025410 3:88042875-88042897 CAATGGCACTGAGGTTCATCAGG + Intergenic
959099737 3:101996882-101996904 CATTTTCAGTGTGTTTTAGCAGG + Intergenic
960523273 3:118680495-118680517 TATTTGCACTGATGTTCAACTGG + Intergenic
965371207 3:167864232-167864254 AATTTGCACAGAGGTGCAGCAGG - Intergenic
965389100 3:168082545-168082567 CTTTTGCACTGAGTTCGAGCAGG - Intronic
966629833 3:182060052-182060074 CCTTTTCACTGAAGTCTAGCAGG + Intergenic
967285862 3:187869042-187869064 CATTTGAACGAAGGTGTAGCTGG - Intergenic
975624454 4:76330224-76330246 GGTTTGAACTCAGGTTTAGCTGG - Intronic
975868074 4:78746262-78746284 CCTTTGCACTGAGGTCAAGTTGG - Intergenic
977066235 4:92319509-92319531 CCTTTGGCCTGAGGATTAGCAGG + Intronic
983223273 4:165063246-165063268 CAATTTCACTGAGTTTTAGACGG - Intergenic
985096064 4:186414439-186414461 CACTTGCTCTGAGCTGTAGCAGG - Intergenic
986182315 5:5404820-5404842 CATTTGACATGAGGTTTGGCCGG - Intergenic
987018310 5:13843762-13843784 AATTTGCACTGATGTTTTGAAGG - Intronic
988256424 5:28825369-28825391 CATTTGGCCTGTGGTTTTGCAGG + Intergenic
988701029 5:33674652-33674674 AATTTGCACTGGGGTGTTGCAGG - Intronic
991628757 5:68632562-68632584 GCTTTTCTCTGAGGTTTAGCAGG + Intergenic
993584033 5:89701117-89701139 CATGTGCACTGAAGTTTAATGGG + Intergenic
994008276 5:94867657-94867679 ACTTTGCTCTGAGCTTTAGCTGG - Intronic
997399342 5:133590585-133590607 CAGCTGCTTTGAGGTTTAGCTGG - Intronic
998216246 5:140240449-140240471 TCTGTGCACTGAGGCTTAGCTGG - Intronic
1000000205 5:157131155-157131177 CTTCTGCACAGATGTTTAGCGGG + Intronic
1002415781 5:179120370-179120392 CATATGCACTTTGGTTTATCAGG - Intronic
1007985715 6:46205299-46205321 TATTGGCCCTGGGGTTTAGCGGG - Intergenic
1009515782 6:64615312-64615334 CATTTGCACTAAAGATTAGTGGG + Intronic
1012261534 6:97092834-97092856 CTCTAGCACTGAGGATTAGCTGG - Intronic
1015136409 6:129877145-129877167 CATTTACACACATGTTTAGCAGG - Intergenic
1023491362 7:40746063-40746085 CATTTCCAATGAAGTTTAGAGGG + Intronic
1031041911 7:116847436-116847458 CAATTTCACTGATGTTTAGAAGG + Intronic
1032783646 7:135184151-135184173 CATTTGCAGGGAGGATTACCAGG + Exonic
1033658634 7:143389336-143389358 CAGCTGCACTGAGGTTCTGCGGG - Intronic
1035993156 8:4514963-4514985 CATTTCCACTGAGGCTTAAAAGG - Intronic
1036077670 8:5519768-5519790 CATTTCCACTGTGCTTTTGCTGG + Intergenic
1037995499 8:23349379-23349401 CATTTTCCCTGAGGATTGGCAGG - Intronic
1038395929 8:27245412-27245434 CATTTGAACCGAGGTCCAGCTGG + Intronic
1051442414 9:17099913-17099935 AATTTGCTCTGTGGTTGAGCTGG - Intergenic
1058103556 9:100943984-100944006 CTTTTGCATTTAGGTTTATCAGG + Intergenic
1186183276 X:6993435-6993457 CATTTCCACTGAGGTATCTCTGG + Intergenic
1189672541 X:43426253-43426275 CATTTGCCCTGAGGGTCAGCAGG - Intergenic
1193351165 X:80466284-80466306 TATTTGCACTGATGTTCATCAGG - Intergenic
1193360466 X:80573770-80573792 CATTCGCACTGAGTTTGACCAGG - Intergenic
1193602717 X:83527553-83527575 TATTTGCACTGCTGTTTAGAGGG - Intergenic
1194334070 X:92623825-92623847 CATTTTCACCAAGGGTTAGCTGG + Intergenic
1196413076 X:115440450-115440472 CTTTTGAAGTGAGGTCTAGCAGG + Intergenic
1200642753 Y:5742819-5742841 CATTTTCACCAAGGGTTAGCTGG + Intergenic
1202094081 Y:21226879-21226901 CTGTTACACTGAGGTTGAGCTGG + Intergenic