ID: 1136121532

View in Genome Browser
Species Human (GRCh38)
Location 16:28138943-28138965
Sequence CACCTTTGTCATCTTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136121532_1136121535 28 Left 1136121532 16:28138943-28138965 CCAACCTCAAGATGACAAAGGTG 0: 1
1: 0
2: 2
3: 28
4: 224
Right 1136121535 16:28138994-28139016 TATAATAACAATGCTCCATGAGG 0: 1
1: 0
2: 4
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136121532 Original CRISPR CACCTTTGTCATCTTGAGGT TGG (reversed) Intronic
904900175 1:33851003-33851025 CACTGTTGTCATCTTGATGGGGG - Intronic
905493459 1:38363621-38363643 CTGCATTCTCATCTTGAGGTTGG - Intergenic
910631198 1:89356510-89356532 CATCTTTGTTATCTTGGTGTGGG - Intergenic
910790870 1:91048924-91048946 AATCTTTGTGATCTTGAGTTAGG - Intergenic
911658655 1:100475376-100475398 CATCTCTGTCATCTTGGTGTTGG + Intronic
912498239 1:110105154-110105176 CACTTTTATCATCCTGAGGCAGG + Intergenic
912530964 1:110321525-110321547 AACCATTGTCTTCTTGAGGATGG - Intergenic
913489983 1:119370081-119370103 CAGCTTTGCCTTCTTGAGGATGG + Intronic
918025769 1:180744463-180744485 CATCTGTGTCATCTTGGAGTTGG + Intronic
919167366 1:193912520-193912542 GCCCGTTGTCATCTTGAGTTTGG + Intergenic
921751362 1:218798039-218798061 CACCAGTGTCTTCTTGAGGGTGG - Intergenic
922918775 1:229282916-229282938 AACATTTGTCATCTTGACATAGG + Intronic
923472720 1:234306671-234306693 CACCTTTTTCATCTCCAGGATGG + Intronic
923944322 1:238865275-238865297 CAGGTTTTTCAGCTTGAGGTTGG + Intergenic
924073241 1:240305142-240305164 CATCTGGGTCATCTTGAGGTTGG + Intronic
1063209210 10:3863680-3863702 TGCCTTTGTCATCTTGAAGGAGG + Intergenic
1063649142 10:7915730-7915752 CACCTTTGGGAGGTTGAGGTGGG + Intronic
1064168198 10:13004569-13004591 GACCTTTTCCATCTTGGGGTGGG - Intronic
1065665966 10:28060998-28061020 CACCTTTGTTATATTGATTTGGG - Intronic
1068925392 10:62530596-62530618 TATCTTTGTCATCTTGGAGTTGG - Intronic
1069352711 10:67548677-67548699 CAACTTTATAATCTTGAGTTAGG + Intronic
1069412334 10:68166496-68166518 TTCCTTTGTCATCTTCAGGCAGG - Exonic
1070185924 10:74062571-74062593 CATCTTTGTCATTTCTAGGTCGG + Intronic
1070342635 10:75511594-75511616 AACATCTGTCATCTTGGGGTGGG - Intronic
1071769830 10:88715900-88715922 CAAATTTGCAATCTTGAGGTAGG - Intergenic
1072416705 10:95252569-95252591 CATCTCTGTCATCTTGGTGTTGG - Intronic
1073214691 10:101829783-101829805 CGGCTTTGCCATCTTGGGGTGGG - Intronic
1074518702 10:114197526-114197548 CATTTTTGTCATCTTGATGTTGG + Intronic
1075548191 10:123372014-123372036 AATCTTTGTGATCTTGAGGTAGG - Intergenic
1076374550 10:129974363-129974385 CCCCTTTGTCATCTTCACTTGGG + Intergenic
1078769628 11:14336404-14336426 CATCTTTGTTATCTCGATGTTGG - Intronic
1080463558 11:32476285-32476307 TACCTTTTCCATATTGAGGTAGG - Intergenic
1081982499 11:47276893-47276915 CACCTCTGTCTTCCTGAGGGAGG + Intronic
1084449360 11:69226450-69226472 CATCTCTGTCATCTTGGTGTTGG + Intergenic
1084721898 11:70911753-70911775 CACTCTTGTCATTTTGGGGTAGG - Intronic
1084755736 11:71237563-71237585 CGGCTTTGTGATCTTTAGGTTGG - Intronic
1085853565 11:80150307-80150329 CACCTTAGCCATCTTGAGGTGGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088640399 11:111867366-111867388 CACCTCTGTCATCTTGGTGTTGG - Intronic
1089744547 11:120607589-120607611 CAGCTTTGCCATGTTGAGTTTGG + Intronic
1090096118 11:123742978-123743000 CACCTCTCTCTTCTTGAGCTGGG - Intergenic
1090988123 11:131791253-131791275 TACCTTATTCATCTTGATGTTGG - Intronic
1091663772 12:2403797-2403819 CATCTTCGTCATCTTGTGGTGGG - Intronic
1092014547 12:5147487-5147509 AACCTTTGTGATCTTGAGCTGGG - Intergenic
1092907003 12:13110167-13110189 TACCTTATTCATCTTGGGGTAGG + Intronic
1096035235 12:48462038-48462060 CACCTTTCTCATCTTGACACTGG - Intergenic
1096435515 12:51587648-51587670 ACCCTTTGTCATGTTGAGGAAGG - Intergenic
1098576204 12:72046160-72046182 CATCTCTGTCATTTTGATGTTGG + Intronic
1102066285 12:109978824-109978846 CATTTGTGTCATCTTGGGGTTGG + Intronic
1102446131 12:113004191-113004213 CACCTTTGTCTTTAAGAGGTGGG - Intronic
1103465739 12:121140634-121140656 CTCCTTGGTCTTCTTCAGGTTGG - Intronic
1104361513 12:128137545-128137567 CATCTTTGTGACCTTGGGGTGGG - Intergenic
1104503016 12:129303919-129303941 CCCCTCTGTCTTCTTGAGCTGGG - Intronic
1104868461 12:131976222-131976244 TACGTGGGTCATCTTGAGGTTGG + Intronic
1106870326 13:34012089-34012111 CACCTTTCTCATATTGAAGAAGG - Intergenic
1107697822 13:43018006-43018028 CCCCATTGTCATCTTGATGCTGG + Intergenic
1108072640 13:46644142-46644164 TAGTTTTGTCATCTTTAGGTTGG + Intronic
1108298916 13:49054575-49054597 CACCTTTCTCATCTCCAGATGGG + Intronic
1110077275 13:71262469-71262491 CACCTGTATAATATTGAGGTTGG - Intergenic
1111784549 13:92770653-92770675 CATCTTTGTCATCTTGTTGTTGG + Intronic
1112464630 13:99632817-99632839 CATCTCTATCATCTTGAGTTTGG - Intronic
1113433132 13:110267347-110267369 CATCTTTGTGAGCTTGAGTTGGG - Intronic
1114700597 14:24674172-24674194 CTCTTTTCTCATTTTGAGGTGGG + Intergenic
1115390229 14:32846018-32846040 CACCCTTGTCATCTTCACTTGGG - Intergenic
1115856446 14:37634127-37634149 CATCTCTGTCATCTTGACTTTGG - Intronic
1116009385 14:39333139-39333161 CATCAGGGTCATCTTGAGGTTGG + Intronic
1117451672 14:55856995-55857017 AACCTTTGTGATCTGGAGTTAGG - Intergenic
1118347165 14:64948665-64948687 CACCTCTTTAATGTTGAGGTTGG + Exonic
1120835388 14:89034511-89034533 CACTTTTTGCATCTTGGGGTAGG + Intergenic
1121824756 14:97001032-97001054 CACCTCTTTCATGTTGGGGTGGG - Intergenic
1123409805 15:20048773-20048795 CTCCTTTGTCATGTGGAGGTGGG + Intergenic
1123519137 15:21055481-21055503 CTCCTTTGTCATGTGGAGGTGGG + Intergenic
1124152575 15:27195213-27195235 CATCTGTATCATCTTGATGTTGG + Intronic
1124185455 15:27523529-27523551 CAACTGTGTCATCTTGATTTTGG - Intronic
1124683834 15:31761101-31761123 AATCTTTGTAATCTTGAGTTAGG + Intronic
1126026080 15:44447693-44447715 CACATTCTTCATCTTGATGTTGG + Intronic
1129005759 15:72372084-72372106 CACACCTGTAATCTTGAGGTGGG + Intronic
1129646057 15:77434278-77434300 CACCTTTATGATCTTGGAGTAGG + Intronic
1130700952 15:86180593-86180615 AACCTTTGTGATCTTCAGCTAGG + Intronic
1131728659 15:95255440-95255462 CATTTGTGTCATCTTGATGTTGG + Intergenic
1131984723 15:98031026-98031048 TATCTTTGTGATCTTGGGGTAGG - Intergenic
1132086138 15:98909725-98909747 CATCTTTTTCATGTTGGGGTGGG - Intronic
1132297176 15:100748063-100748085 CGTCTTTGTCATCCTGATGTTGG + Intergenic
1132811718 16:1802491-1802513 CATCTCTGTCATCTTGGGTTAGG - Intronic
1134370076 16:13615150-13615172 CACTTTGGTCATTATGAGGTGGG - Intergenic
1135502996 16:23013379-23013401 CATCTTTGTCCTCCAGAGGTGGG - Intergenic
1136121532 16:28138943-28138965 CACCTTTGTCATCTTGAGGTTGG - Intronic
1137231981 16:46574882-46574904 CTCTTTCGTGATCTTGAGGTGGG - Intergenic
1139688344 16:68621923-68621945 CATCTTTCTCTTCTTGAGATGGG - Intergenic
1141162402 16:81638232-81638254 CACGTTTGGGATCTTGAGATGGG - Intronic
1141189983 16:81817579-81817601 CATCTTTGTCATCTTCTGGAAGG - Intronic
1141207031 16:81940443-81940465 GACCTTTGGCATCTTGGGGGGGG + Intronic
1141986758 16:87585317-87585339 GATCTCTGTCATCTGGAGGTAGG + Intergenic
1142217131 16:88835249-88835271 CACCTTCGTCTTCTTCACGTCGG - Exonic
1146151391 17:30475678-30475700 CATCTGTGTCATCTTGATGTTGG - Intergenic
1146912034 17:36654697-36654719 GACTTTTGGGATCTTGAGGTAGG + Intergenic
1148241234 17:46000605-46000627 ACCTGTTGTCATCTTGAGGTGGG + Intronic
1149298062 17:55278750-55278772 CACCTTAGTCATTATGATGTGGG + Intronic
1149711473 17:58746181-58746203 CACTTTTCCCATCTGGAGGTGGG + Intergenic
1153499721 18:5736008-5736030 CATCTTTGTCATCTTCATGTTGG - Intergenic
1153982168 18:10319829-10319851 CAGGTTTGTCATCATGTGGTAGG + Intergenic
1155038521 18:22045467-22045489 AACCTTTGTCATCTGGAGGCTGG - Intergenic
1157855634 18:51102675-51102697 AATCTTTGTGATCCTGAGGTAGG - Intergenic
1157866505 18:51191079-51191101 CTACTTTCTCATCTTGAGTTTGG + Intronic
1159379014 18:67632209-67632231 CACCTTTGTCATTTAGAGGGAGG + Intergenic
1159892945 18:73969688-73969710 TATCTTTGTCACCTTGAGGTAGG + Intergenic
1161245996 19:3252353-3252375 CAGCTTTGTCCTCTTTGGGTGGG + Intronic
1163300772 19:16444651-16444673 CACCTTTGTCATCTGAAGTGAGG - Intronic
1163321918 19:16579704-16579726 CTCCTTTATCATGTTGGGGTGGG - Intronic
1167197685 19:48041901-48041923 CACTTTTTTCATCTGGAGATTGG - Intronic
1167570426 19:50284308-50284330 AACCTTTGTGACCTTGAGTTAGG - Intronic
927052271 2:19341973-19341995 CATCTGTGTCATCTTGATGTTGG - Intergenic
929090427 2:38211213-38211235 CAGCTTTCTCATCTTGGTGTTGG - Intergenic
931019688 2:58029661-58029683 CTCCCCTGTCATATTGAGGTTGG + Intronic
931028948 2:58148594-58148616 TAACTTTGTGACCTTGAGGTAGG - Intronic
933509312 2:83219380-83219402 CACCTTGGACATTTTCAGGTTGG - Intergenic
933968053 2:87446536-87446558 CCCCTTTGACATCTTGATTTTGG - Intergenic
935020420 2:99224995-99225017 CATCTGGGTCATCTTGGGGTTGG + Intronic
935270399 2:101429614-101429636 CACCTCTGGCATCTTGAGAATGG - Intronic
935522744 2:104127875-104127897 CACCTGTGTCATCTTGATGTTGG - Intergenic
935825202 2:106940984-106941006 CACCTTTGTCATCATCATGTAGG + Intergenic
935932597 2:108144717-108144739 GACCTTTGTCAGCTGGATGTAGG - Intergenic
936325743 2:111503977-111503999 CCCCTTTGACATCTTGATTTTGG + Intergenic
938220628 2:129563760-129563782 TAACTTTGTGATCTTGGGGTAGG - Intergenic
938866852 2:135431415-135431437 TATCTTTGTGATCTTGAGTTAGG + Intronic
939318712 2:140586888-140586910 CACCCCTGTCATCTTGGTGTTGG - Intronic
939772528 2:146339450-146339472 AAACTTTGTCATCTACAGGTGGG + Intergenic
940690497 2:156913566-156913588 AACCTTTGTGAACTTGAGTTAGG - Intergenic
943596380 2:189862449-189862471 CATCTGGGTCATCTTGAGGTTGG + Intronic
943679576 2:190753805-190753827 CATCTGTGTCATCTTGGTGTTGG - Intergenic
944084400 2:195827690-195827712 CACCTATGTGAGGTTGAGGTGGG - Intronic
946326958 2:218989575-218989597 CACCTTTGCCACCTTGTGGGTGG - Intergenic
947678238 2:232005020-232005042 CATCTGAGTCATTTTGAGGTTGG + Intronic
948854977 2:240725849-240725871 CCCCTTTGTCTTCCTGAAGTGGG + Intronic
948967162 2:241391797-241391819 CAGCTTTAACATCTTGAGCTTGG - Intronic
1169008865 20:2232981-2233003 CAATTTTGTCATCTTGCTGTAGG + Intergenic
1169145917 20:3252256-3252278 CTCCTTTGGGCTCTTGAGGTTGG - Exonic
1170182436 20:13547199-13547221 CACATTTGCCATTTTGAGGTTGG - Intronic
1171326594 20:24299599-24299621 AATCTTTGTTATCTTGAGATAGG - Intergenic
1172964194 20:38821822-38821844 CACCTGGGTCACCTTGAGATTGG + Intronic
1173899985 20:46580709-46580731 CATCTATGTCATAGTGAGGTAGG + Intronic
1174127556 20:48318030-48318052 CATCTGTGTTATCTTGATGTTGG - Intergenic
1174451612 20:50624251-50624273 CAAGTTTGCCATCTTGAGGCTGG + Intronic
1177190222 21:17843195-17843217 TAACTTTGTGACCTTGAGGTAGG + Intergenic
1179895928 21:44363647-44363669 CATCTGTGTCATCTTGGCGTTGG + Intronic
1180089267 21:45525458-45525480 GACCTTTGTCCTCTTCAGGAAGG - Intronic
1180916510 22:19492581-19492603 CAACTCTGTCATCTTGCTGTTGG + Intronic
1182915608 22:34026734-34026756 CACATCTGTCATGTTCAGGTAGG - Intergenic
949089965 3:15472-15494 CAGCTTTGTCATCTTAAAATTGG + Intergenic
949560215 3:5194476-5194498 CACCCTTGTCATCCTGAAGTTGG + Intronic
951854639 3:27181418-27181440 CATCTTTGTCATCTTCACATTGG + Intronic
952808603 3:37381235-37381257 CATCTCTGTCATCTTGGTGTTGG + Intergenic
954772378 3:52983194-52983216 CATCCTTGTCATCTTCACGTTGG - Intronic
955646604 3:61145108-61145130 AATCTTTGTCATCTTGAGTTAGG - Intronic
956218120 3:66871589-66871611 CATCTGGGTCATCTTGAGGTTGG - Intergenic
956259411 3:67322257-67322279 CATCTTTGTCAACTTGGTGTTGG + Intergenic
957025366 3:75175483-75175505 CGACTTTGTCATCTATAGGTCGG - Intergenic
957029636 3:75225199-75225221 CAGCTTTGTCATCTTAAAATGGG + Intergenic
959690541 3:109192963-109192985 CTCCTTTGTCATTTTTTGGTTGG - Intergenic
959958855 3:112273198-112273220 CACCTTAGTCAACTTCAGGAAGG + Intronic
960099978 3:113731363-113731385 AATCTTTGTGATCTTGAGTTAGG - Intronic
960175196 3:114509516-114509538 CACAATTGGCTTCTTGAGGTGGG - Intronic
960434126 3:117604603-117604625 CAACTTAATCATCTTGATGTTGG + Intergenic
962181956 3:133215449-133215471 CACCTTGTTCATCTTAAGCTGGG + Intronic
962632132 3:137288972-137288994 CATCTGTGTCATCTTAATGTCGG + Intergenic
963967898 3:151393699-151393721 TACCTTTGTCATAGTGAGTTTGG + Intronic
964017170 3:151961971-151961993 CAGCTTTGTCATCTTGGTGCTGG + Intergenic
965723154 3:171684146-171684168 CACCTCTGTCAACCTGGGGTAGG + Intronic
965933349 3:174074456-174074478 CACCCTTGTCATCATGTAGTTGG - Intronic
966987508 3:185195166-185195188 CATCTTTGTGATCTTGAATTAGG + Intronic
970706360 4:18808416-18808438 AATCTTTGTGATCTTGAGATAGG + Intergenic
972091276 4:35287888-35287910 CACCATTGTCATCAATAGGTTGG - Intergenic
976638756 4:87315008-87315030 CAGCATTGTAATCTTGAGGCAGG + Intronic
976840586 4:89428209-89428231 CCACTTTGTTATCTGGAGGTAGG + Intergenic
977855899 4:101891983-101892005 CATCTTTGTCCTCTTGGTGTTGG + Intronic
980210850 4:129785408-129785430 CATCTTAGTCATCCTGGGGTAGG + Intergenic
980573525 4:134655910-134655932 CACCATTTTCATCTTGATGAAGG - Intergenic
982658724 4:158180496-158180518 CAGCTTTGTCATTATCAGGTGGG + Intergenic
983690057 4:170457587-170457609 AATCTTTGTAATCTTGGGGTAGG - Intergenic
984343250 4:178486556-178486578 CACTTTTGTCATCTGGAGAGTGG + Intergenic
987768884 5:22273622-22273644 CAACTTTTTCTTCTTCAGGTAGG - Intronic
989555474 5:42789897-42789919 TATCTTTGTGATCTTGAGTTAGG + Intronic
992126140 5:73643896-73643918 TATCTTTGTCATCTAGATGTGGG + Intronic
992191098 5:74292912-74292934 CACCTTTGGCATCTTAAAGTAGG - Intergenic
992432988 5:76727827-76727849 CATCTGGGTCAACTTGAGGTTGG + Intronic
993535957 5:89086966-89086988 CCCTTTTTTCATCCTGAGGTGGG - Intergenic
995264275 5:110139462-110139484 CACCTTTGTTGGCTGGAGGTGGG + Intergenic
995738804 5:115332998-115333020 CATCTCTGTCATCTTAATGTTGG + Intergenic
996644490 5:125797421-125797443 CTCCTTTGGCCTTTTGAGGTAGG - Intergenic
998746776 5:145269556-145269578 AACCTTTGTGCCCTTGAGGTGGG + Intergenic
998749376 5:145301577-145301599 TAACTTTGTAAACTTGAGGTAGG - Intergenic
998795733 5:145816502-145816524 AATCTTTGTCATCTTGGGTTAGG - Intronic
998834363 5:146189679-146189701 GAACTTTGTCATCTGAAGGTAGG - Intergenic
999125866 5:149245315-149245337 AACTTTTGTCATCTTCAGGCTGG - Intronic
1001531881 5:172469065-172469087 CATCTGTGTCATCTTGATGTTGG + Intergenic
1005806061 6:29475509-29475531 CACCTCTGCCATGGTGAGGTGGG - Intergenic
1006876253 6:37299703-37299725 TATTTTTGTAATCTTGAGGTGGG - Intronic
1008684227 6:53906306-53906328 CATCTGTGTGACCTTGAGGTAGG + Intronic
1012375354 6:98555401-98555423 CACCTTTGTGATCTAGTGGTTGG + Intergenic
1013986373 6:116198968-116198990 CACTATTGTCATCTTGAACTGGG + Intronic
1014062320 6:117085821-117085843 CATGTGTGTCATCTTGATGTTGG - Intergenic
1015647819 6:135414364-135414386 CACCTTTGTGAGCTTGGGTTAGG + Intronic
1015946420 6:138505714-138505736 CCCCTTTCTCCTCTTCAGGTTGG - Intronic
1016376722 6:143428944-143428966 CAGCTTTGTGATCTTGGGTTAGG + Intronic
1017472889 6:154757820-154757842 CATCTGTGTCATCTTGGGATTGG + Intronic
1018647863 6:165964794-165964816 CACCTTTCTCATCATTATGTGGG - Intronic
1018804227 6:167246433-167246455 CAACTTTGTCAGCTTGAAGCAGG + Intergenic
1019305923 7:335715-335737 CACCTTTGTCCTCTCCAGCTGGG + Intergenic
1020183455 7:5940584-5940606 CATCTTTGTCATCTTGGAGATGG - Intronic
1020299455 7:6784174-6784196 CATCTTTGTCATCTTGGAGATGG + Intronic
1021145568 7:17084756-17084778 CATCTTTGTCTTACTGAGGTGGG - Intergenic
1023988612 7:45113633-45113655 CACCTATGTGATGTTGAGGTGGG + Intergenic
1024016766 7:45324500-45324522 CATCTGTGTCATCTTGATATTGG + Intergenic
1024288510 7:47781948-47781970 CACCTTTGTCAAGATGAGTTTGG + Intronic
1026022289 7:66718406-66718428 CATCTGTGCCATCTTGGGGTTGG + Intronic
1026886716 7:73953657-73953679 CATCTGTGCCATCTTGTGGTTGG + Intergenic
1028673605 7:93433112-93433134 AAACTTTGTCATGTTGCGGTTGG + Intronic
1033877543 7:145841702-145841724 CACCTTAGTGGTCTTGAGGAAGG + Intergenic
1034327374 7:150248780-150248802 CACCTGAGTCATCTTTATGTTGG - Intronic
1034765834 7:153720665-153720687 CACCTGAGTCATCTTTATGTTGG + Intergenic
1038532645 8:28331057-28331079 CTCCTCTGTTATCTGGAGGTGGG - Intronic
1039576951 8:38631376-38631398 AACCTTTGGGATTTTGAGGTTGG - Intergenic
1040751740 8:50717904-50717926 CCCCTTCGACATCTTGAGGATGG - Intronic
1041184606 8:55286157-55286179 CACAATTGTCATTTTGAGGGAGG - Intronic
1041308267 8:56486075-56486097 AATCTCTGTCATCTTGAAGTTGG - Intergenic
1042127511 8:65553490-65553512 CACTTTTGTCTTCTTTGGGTTGG - Intergenic
1042835181 8:73073061-73073083 CTCTGTTGTCATCTTGAGGAAGG + Intronic
1045466129 8:102471276-102471298 CATCTCTGTCATCTTGGTGTTGG - Intergenic
1046746095 8:117877628-117877650 CTGCTTTGTCATCGTTAGGTTGG - Intronic
1046945515 8:119970916-119970938 CCCCTTTGCCATCTGAAGGTTGG + Intronic
1047630131 8:126697778-126697800 TATCTTTTTCTTCTTGAGGTAGG + Intergenic
1051449668 9:17181507-17181529 CATCTCTGTCATCTTGGTGTTGG + Intronic
1051505360 9:17821185-17821207 CATCTATGTCATCTTGATGTTGG + Intergenic
1052635302 9:31095472-31095494 CATCTTTTTCTTCTTGAGATGGG - Intergenic
1055306999 9:74940429-74940451 CATTTGTGTCATCTTGAGTTTGG + Intergenic
1055426019 9:76197720-76197742 CACCTCTACCATCTTGTGGTTGG - Intronic
1055920073 9:81451063-81451085 CACATTTGTCATCATGAGAAAGG - Intergenic
1056847316 9:90051903-90051925 CATTTCTGTCATCTTGACGTTGG + Intergenic
1057039340 9:91836138-91836160 TTCCTTTGTCATCTGGTGGTGGG + Intronic
1057157415 9:92855323-92855345 CACAATTGTCATCTAGAGATGGG - Intronic
1058757883 9:108100590-108100612 CAGTAGTGTCATCTTGAGGTAGG - Intergenic
1059087472 9:111319864-111319886 CATCTTTGTAATGTTGGGGTTGG + Intergenic
1060386812 9:123237978-123238000 CACCTGTGTAACCTTGAGATCGG + Intronic
1060585249 9:124781489-124781511 AACTTGTGTCATCTTGAAGTTGG - Intronic
1061169939 9:128946865-128946887 CACTTGTGTCATCTTGGGCTTGG - Exonic
1062596963 9:137303846-137303868 CACCTTTGGCCTCTTAAGGAGGG + Intergenic
1189308412 X:40004444-40004466 CACCTTTGTCATGTTGATCCGGG - Intergenic
1190080325 X:47351949-47351971 CATCTGAGTCATCTTGATGTTGG + Intergenic
1190384112 X:49867985-49868007 CATCTGTGTCATCTTGTGGTTGG + Intergenic
1190463439 X:50701814-50701836 TATCTTTGTGACCTTGAGGTGGG + Intronic
1190968533 X:55326682-55326704 CATCTCTGTCATTTTGATGTTGG + Intergenic
1196256924 X:113531000-113531022 CATCTTTGACATTTTGTGGTTGG + Intergenic
1197413007 X:126141602-126141624 CATCTCTGTCATCTTGATGTTGG + Intergenic
1199496877 X:148462116-148462138 CACTTTTCACATCTTGAGTTGGG + Intergenic
1199707561 X:150443866-150443888 CATCTGTGTCATCTTGCTGTTGG + Intronic