ID: 1136123901

View in Genome Browser
Species Human (GRCh38)
Location 16:28162415-28162437
Sequence ATCAAGTTCTCTATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136123898_1136123901 -9 Left 1136123898 16:28162401-28162423 CCTAAGAGAGCTTTATCAAGTTC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 1136123901 16:28162415-28162437 ATCAAGTTCTCTATGGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1136123897_1136123901 1 Left 1136123897 16:28162391-28162413 CCAATGCAAACCTAAGAGAGCTT 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1136123901 16:28162415-28162437 ATCAAGTTCTCTATGGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136123901 Original CRISPR ATCAAGTTCTCTATGGAAGA GGG Intronic
900285308 1:1896264-1896286 ATAAAGGACTCTAAGGAAGAAGG - Intergenic
906007521 1:42489101-42489123 ATGTATTCCTCTATGGAAGAAGG - Intronic
908077382 1:60535369-60535391 ATTTAATTCTCTATTGAAGATGG + Intergenic
909373162 1:74910570-74910592 ATCAAATTCTCTATAGTAAATGG - Intergenic
909623767 1:77693215-77693237 AGCAAGTGCTTTCTGGAAGAGGG - Intergenic
909723561 1:78806822-78806844 ATCAAGTTCTATATGGATCATGG - Intergenic
914325675 1:146613195-146613217 TTCAAGTTCTCTAAGGAAAGAGG - Intergenic
916718315 1:167463050-167463072 ATCCAGCTCTCTCTGGAGGATGG + Intronic
917081148 1:171258139-171258161 ATCAAGTGCTGTCTGGAAGAAGG + Exonic
917318040 1:173749000-173749022 ATCAGGTTCACTTTGGAGGAAGG - Intronic
917451797 1:175153514-175153536 CACTAGCTCTCTATGGAAGACGG + Intergenic
917873650 1:179265496-179265518 TTCAAATACTCTCTGGAAGAAGG + Intergenic
918416639 1:184315975-184315997 ATGAAGTTCTCTATGAATTATGG - Intergenic
919056463 1:192576194-192576216 ATAAATTTCTCTAAGGAATAAGG - Intronic
922864532 1:228848309-228848331 TTCAAATTCTATTTGGAAGAAGG - Intergenic
924175529 1:241387697-241387719 ATCATGTTCTCTATGCCAGAGGG + Intergenic
924496563 1:244595959-244595981 AGCTAGTTCTCTCTGGGAGAGGG + Intronic
1063084413 10:2802598-2802620 ACTAAGTTATCTATGGCAGAGGG + Intergenic
1063307955 10:4923237-4923259 TTCAAATTCTCAATGGAAGTAGG + Intronic
1063946923 10:11185963-11185985 TTCAAGTTAACTATGTAAGAAGG + Intronic
1068897244 10:62219437-62219459 ATAATGTTCTTTATGGCAGAGGG - Intronic
1070562353 10:77577467-77577489 ATCCAGGTTTCTATGCAAGATGG + Intronic
1071286881 10:84157020-84157042 ATCAAGCTCTCTGTAGAAGGTGG - Intergenic
1071455526 10:85848575-85848597 ATCATGATCTCTATGTATGAAGG + Intronic
1071692578 10:87837785-87837807 CCCAACTTCTCCATGGAAGAAGG + Intronic
1072294079 10:93993485-93993507 ATCAAGGTCTCTGTAGTAGATGG - Intergenic
1074973541 10:118563447-118563469 AGCAAGCTCTCTAGGGAACAAGG - Intergenic
1076064757 10:127440400-127440422 ATCAAGTTCGCCCTGGAAGTGGG - Intronic
1079918196 11:26397489-26397511 ATGAAGTTCTCTATATAAAAAGG + Intronic
1081237927 11:40668476-40668498 ATAAAGTTCGCAAGGGAAGAAGG + Intronic
1083389135 11:62335244-62335266 ATCAAGGTCTCTTGGCAAGAAGG - Intergenic
1084044980 11:66563203-66563225 CTGAGGTTCTCTATGCAAGATGG + Exonic
1085234062 11:74998160-74998182 ATCAAGTTCACCATGTAATATGG + Intronic
1086245511 11:84747141-84747163 AACAAGTTCTGTGAGGAAGAAGG + Intronic
1086324497 11:85684448-85684470 ATCAAGTTCTTTAACAAAGAAGG - Intergenic
1087136697 11:94728173-94728195 ATCAAGATCTCTTTGTAATATGG + Intronic
1088318605 11:108532165-108532187 AAAAAATTCTCTATGGCAGAAGG - Intronic
1090226545 11:125075398-125075420 CTCAAGTTGTCTAGGGAAGCTGG - Intronic
1091858403 12:3757124-3757146 ATCAAGGTGACTCTGGAAGAGGG - Intronic
1096877763 12:54644002-54644024 TTGAAGATCTCCATGGAAGAAGG - Intergenic
1097677661 12:62620345-62620367 AATAACTTCTCTATGGAAAATGG - Intergenic
1102106947 12:110333402-110333424 ATCAGGTTCTGAATGGAAGGGGG - Intronic
1102856402 12:116298341-116298363 TTCAAGTTCTGTATTGCAGAGGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104098001 12:125577668-125577690 CTCTAGTTCTCTAAGGTAGAAGG + Intronic
1105310696 13:19206973-19206995 ATTAAGTTCTTTATGGGCGAGGG + Intergenic
1105360366 13:19708036-19708058 ATTAAGTTCTTTATGGGCGAGGG + Intronic
1106908049 13:34430016-34430038 TTCAAATTCTCTATGGTAGATGG - Intergenic
1110172204 13:72514996-72515018 AAAAAGCTCTCAATGGAAGAGGG - Intergenic
1110898815 13:80793901-80793923 ATCTCGTTCTCTATGATAGATGG + Intergenic
1110952096 13:81507651-81507673 ATCAATTTCTTTTTGGAAGTGGG + Intergenic
1112107376 13:96255664-96255686 AGCAAGTTTTATATGGAAGTTGG - Intronic
1112935383 13:104791286-104791308 ATCATCTTCTCTATGGACTAGGG - Intergenic
1113276279 13:108734348-108734370 ATCAATTTTTCTAGAGAAGAAGG - Intronic
1116239962 14:42328095-42328117 ACTAAGTTCTCTTTGGACGATGG - Intergenic
1120067159 14:80056161-80056183 ATGAAGTCTTCTATGGAAGCTGG - Intergenic
1120161062 14:81144807-81144829 ATCAAGTTCTCTTTGTATCAGGG - Exonic
1122503969 14:102219877-102219899 TTCAAGATCTCTCTGGAAGCTGG + Intronic
1125178507 15:36853800-36853822 AACATGTTCTCTATGGATAAAGG + Intergenic
1126482797 15:49144766-49144788 ATCAAGCTGTCTATGGAGCAGGG - Intronic
1136123901 16:28162415-28162437 ATCAAGTTCTCTATGGAAGAGGG + Intronic
1136922033 16:34341054-34341076 ATCTAGTTCTCTTTGGCAAATGG + Intergenic
1136982540 16:35070752-35070774 ATCTAGTTCTCTTTGGCAAATGG - Intergenic
1137871942 16:51958484-51958506 TTCAAGTTCTGTAAGGAAAAGGG + Intergenic
1139267656 16:65655488-65655510 ATGGAGGGCTCTATGGAAGAAGG - Intergenic
1139354488 16:66359503-66359525 GTCAGGTTCTCCAGGGAAGAGGG - Intergenic
1140007889 16:71097745-71097767 TTCAAGTTCTCTAAGGAAAGAGG + Intronic
1141506033 16:84479356-84479378 CTCAACTTCTCTATTGAGGAGGG - Exonic
1143138461 17:4725965-4725987 ATCAAGGTCTCAATGGAGGTGGG - Intergenic
1143614467 17:8041501-8041523 ACCAAGATCTCTATGTGAGAGGG + Intronic
1146508260 17:33424087-33424109 ATCAGAGTCTCTGTGGAAGAAGG - Intronic
1149006366 17:51810449-51810471 AGCAAGTTCTGTATGGAATCAGG + Intronic
1153556005 18:6314472-6314494 ATCACGTTGTCTATGGTAGGTGG - Intronic
1154401785 18:14045310-14045332 ATCAAGATCTCTGTTGAATAAGG - Intergenic
1154500545 18:14994468-14994490 ATCAAGTTCTCTAGAGAAACAGG - Intergenic
1155606479 18:27612155-27612177 GTCAAATTCTCCATGGAAGCCGG + Intergenic
1155770404 18:29690828-29690850 AACAAGTCCTTTCTGGAAGACGG + Intergenic
1156844454 18:41648163-41648185 ATGAATCTCTCCATGGAAGAGGG - Intergenic
1158077749 18:53550895-53550917 CTCAAGTCCTCTATGTAAAATGG - Intergenic
1159835688 18:73332450-73332472 TTCAAGGTCTCTAGGGAAGAAGG - Intergenic
1160217470 18:76945446-76945468 ATCAACTTCTCTATGTAGGGAGG + Intronic
1166062670 19:40336371-40336393 ATCCAGTTCTTTAAGGAAGCCGG - Exonic
925478062 2:4241286-4241308 AGAAAGTTCTCTAAAGAAGAAGG - Intergenic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
925796855 2:7554929-7554951 ATCAAGTTCTCCATGTAGGTGGG + Intergenic
927093081 2:19727308-19727330 ATCAAGTTCATCATGGAGGAAGG - Intergenic
930168245 2:48224538-48224560 AACAAGATATGTATGGAAGAAGG + Intergenic
930789188 2:55306283-55306305 ATCAAGTTTTCTTTAAAAGATGG - Intronic
934498228 2:94830440-94830462 ATCAATTTTTCAAAGGAAGAGGG - Intergenic
934625653 2:95848455-95848477 ATAAAGTTCTCTCAGAAAGACGG + Intronic
936474288 2:112826185-112826207 ATAAATTTCTTTACGGAAGATGG + Intergenic
936622012 2:114109691-114109713 ATCAAGTTCTCCACACAAGAAGG - Intergenic
936687887 2:114849707-114849729 ATCCACTTTTCTATGGAACATGG - Intronic
938738917 2:134212708-134212730 ATCGAGTTTTCCATGGAAAATGG + Intronic
938961934 2:136351961-136351983 ATCAGAATCTCTTTGGAAGAGGG + Intergenic
940424298 2:153513320-153513342 ATCAACTTCTCTAAATAAGATGG - Intergenic
942448758 2:176096034-176096056 ATTATGTTCTCTATAGATGAAGG + Intergenic
942747880 2:179256379-179256401 TTAAAGTTATCTATGGAAGTTGG - Intronic
946438927 2:219678888-219678910 ATCAGGTTCTCTTTGGCAGTTGG - Intergenic
946592454 2:221265670-221265692 ATCAAATGCTCAATGAAAGATGG + Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
947383662 2:229569545-229569567 TTTAAGTTCTCTATATAAGATGG + Intronic
947416240 2:229899467-229899489 TTCAAGTTGTCTTTGAAAGAGGG - Intronic
948034759 2:234849022-234849044 ATCTGGGTCTCTATGGAAAAGGG - Intergenic
1170338761 20:15300074-15300096 ATCAAGTTCAGTTTGGAGGATGG - Intronic
1174526907 20:51179695-51179717 TTCAATTTCCCTATGGAAAAAGG + Intergenic
1175177198 20:57119192-57119214 ATCAAGTACTCCAAGAAAGAAGG - Intergenic
1179658905 21:42862447-42862469 ATCAAGTCCCTCATGGAAGAAGG + Intronic
949603418 3:5627218-5627240 TTCTAGTTTTCTATGGTAGAAGG + Intergenic
951867316 3:27322755-27322777 AACAAGTACTCTATGAAAGGGGG - Intronic
952567677 3:34679057-34679079 AAGAAGTACTCTATTGAAGAAGG + Intergenic
959538765 3:107516864-107516886 ATCAAGTGCCACATGGAAGAGGG + Intergenic
959920261 3:111860749-111860771 ATAAAGATTTCTAGGGAAGAGGG - Intronic
962408400 3:135119797-135119819 ATAAAGTTCCAGATGGAAGAAGG - Intronic
962881720 3:139584198-139584220 AACAAGTTCTCAAGGAAAGAAGG - Intronic
963092090 3:141492104-141492126 ATCATTTGCTCTGTGGAAGACGG + Intronic
964020962 3:152010142-152010164 ATTAAATTCTATATGGTAGAAGG - Intergenic
967729827 3:192897013-192897035 ATAAATTCCTCTATGGAAGGAGG + Intronic
969652219 4:8474630-8474652 TTCAAGTTCTCTTTGGAAGTCGG + Intronic
972327886 4:38035104-38035126 ATGAAGTTTTGTATGGAAGGGGG + Intronic
972421247 4:38888735-38888757 GTGAAGTTGTCTATGGAAGGAGG + Intronic
972725476 4:41743557-41743579 ATCAGGTGCTATATGGAACAGGG - Intergenic
973635747 4:52861097-52861119 ATTAAGTTCTGGCTGGAAGAGGG + Intergenic
973707815 4:53597457-53597479 AACCAGTTCTCTATGGAAATGGG - Intronic
976602236 4:86949020-86949042 ATCAATTACTATATGCAAGAAGG - Intronic
979286642 4:118933210-118933232 ATCAAGTTCAATAAGGAACAAGG + Intronic
979608213 4:122661890-122661912 ATCAAGCTTCCTAGGGAAGAAGG + Intergenic
982488583 4:155999751-155999773 ATCACATTCTCTGTGGTAGAAGG + Intergenic
982812098 4:159838756-159838778 ATAAAGTGCTCTATTGAAAATGG - Intergenic
982983019 4:162164903-162164925 ATCAATATTTCTATGAAAGATGG + Intergenic
984984716 4:185316785-185316807 ATCAATTTGGCTAGGGAAGATGG - Intronic
985276917 4:188246189-188246211 ATAAAGGTCTGGATGGAAGAGGG + Intergenic
985882452 5:2648956-2648978 AACACGTTTTCTATGGAAAAGGG - Intergenic
986467584 5:8041614-8041636 AACAATTTTTTTATGGAAGAGGG - Intergenic
989106541 5:37868236-37868258 CTCAAGTGCTCTTTGGAAGAAGG + Intergenic
992348835 5:75908671-75908693 ATCCAGATGTCCATGGAAGAAGG - Intergenic
992669398 5:79043735-79043757 TTCAAGTTCTTTAAGGGAGATGG - Intronic
993586776 5:89741045-89741067 AACAAGTCCTCTATGAAATATGG + Intergenic
994604747 5:101953374-101953396 ATCAAGTTTTCTAGAGAAGTAGG + Intergenic
994752624 5:103757442-103757464 CTTAACTTCTCTATGCAAGAGGG - Intergenic
995088054 5:108138857-108138879 ATCAAGTTGCCTATCTAAGAGGG + Intronic
996208752 5:120778532-120778554 ATCTAGTTGTCTATTCAAGACGG - Intergenic
996712218 5:126554524-126554546 ATCTGGTTCTTTATGGAAAAAGG - Intronic
999611833 5:153377992-153378014 ATTATGTTTTCTAGGGAAGAGGG + Intergenic
1005150407 6:22742287-22742309 AACAAGTTCTCTGAGGAAAAAGG - Intergenic
1008047479 6:46866076-46866098 ATCAAAGTCTCTCTGGTAGATGG - Intronic
1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG + Intergenic
1009831032 6:68935307-68935329 AACTAGTGCTCTAGGGAAGAAGG - Intronic
1011104272 6:83761764-83761786 ATTAAGTTCTTTCTGGAAGAGGG - Intergenic
1011449139 6:87473843-87473865 GCCAAGTGCTCTATGGAGGAAGG - Intronic
1012184341 6:96194457-96194479 ATCAATTCTTGTATGGAAGACGG - Intronic
1015437935 6:133211543-133211565 ATTCAGTTCTCTATAGAATAGGG + Intergenic
1015674883 6:135734485-135734507 TTCTAGTTCTCTCTGGTAGATGG + Intergenic
1017402496 6:154079991-154080013 ATCATATTCTATATGGAAAAGGG + Intronic
1017688358 6:156936489-156936511 ATTAGGTTCTCTATAAAAGAAGG - Intronic
1018314393 6:162542651-162542673 ATAATGTTCTCTATGAATGAAGG - Intronic
1021333421 7:19368144-19368166 AACAAGTTCTCTATGAAATCAGG + Intergenic
1022436536 7:30391250-30391272 AGCAAGATCTCTCTGGAAGAGGG + Intronic
1022822310 7:33973741-33973763 GTCACTTTCTCCATGGAAGACGG - Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1032299503 7:130673546-130673568 TTTAAGGACTCTATGGAAGAAGG - Intronic
1032566935 7:132956098-132956120 CTGAGGTTCTCTAAGGAAGAGGG + Intronic
1033194788 7:139318714-139318736 ATCAAGTCCTCTCTAGAAGAAGG - Intergenic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1037915602 8:22771189-22771211 AACAAATTCTCTGTTGAAGAAGG - Intronic
1039111079 8:34041149-34041171 ATCAAGGTTTCGATGGAAGTAGG + Intergenic
1039960863 8:42246734-42246756 TTCAAGTTTTCTAAGGAAGTTGG + Intergenic
1041324039 8:56646025-56646047 ATCAAGTTCTCACAGGAAGTGGG + Intergenic
1042298933 8:67254434-67254456 CTTAAGTTCTTTATGGAAGGTGG - Intronic
1048187146 8:132251717-132251739 CTCAAGTTCTTTCTGGAAGAAGG + Intronic
1049448584 8:142644712-142644734 ATTAAGTTTTCTCTGAAAGAAGG - Intergenic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1055547273 9:77392165-77392187 ATCACTGTCTCTGTGGAAGATGG - Intronic
1055747857 9:79470550-79470572 ATCCATCTCTCTAAGGAAGAGGG + Intergenic
1057782574 9:98061822-98061844 AACAAGTTGTCTCTGGAAGTAGG + Intronic
1058932872 9:109739292-109739314 AACCAGTACTCTAAGGAAGATGG + Intronic
1059003350 9:110374296-110374318 ATCATGTTCTTTGTGGAATATGG - Intronic
1059298124 9:113290645-113290667 ATCCAGTTCTCTGTGGAAGCAGG - Intronic
1059372640 9:113855275-113855297 ATCAATTTTTCAATGGATGATGG - Intergenic
1059891952 9:118813740-118813762 ATCAAATTCTCTCTCTAAGAAGG + Intergenic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1187807885 X:23140970-23140992 CTCAATGTCTCTAAGGAAGAAGG + Intergenic
1188065592 X:25655794-25655816 CTCTACTTCTGTATGGAAGAAGG + Intergenic
1188122491 X:26326207-26326229 TTCAAGTTCTCTATGGAGTATGG + Intergenic
1189925986 X:45955877-45955899 GCCAAGTTCTCCATGCAAGAAGG - Intergenic
1192390464 X:70721377-70721399 TTCAAATTCTTTTTGGAAGAAGG + Intronic
1193339692 X:80333503-80333525 CTCAACTTATTTATGGAAGAGGG + Intergenic
1194099379 X:89684029-89684051 ATCAAGTTCTTTCAGCAAGATGG + Intergenic
1194573576 X:95583069-95583091 ATCATGTTGTCTATGAATGAAGG + Intergenic
1196997853 X:121403319-121403341 ACCAAGTTAGCTAAGGAAGATGG - Intergenic
1199209908 X:145195667-145195689 GTCACGACCTCTATGGAAGAAGG - Intergenic
1199549441 X:149042619-149042641 AGCAAGGTCACAATGGAAGAAGG - Intergenic
1200452386 Y:3345408-3345430 ATCAAGTTCTTTCAGCAAGATGG + Intergenic
1200778191 Y:7189372-7189394 ATCCAGTGCTATATGGCAGAGGG + Intergenic
1201509058 Y:14737233-14737255 ATCAAGTCCACTTTGGAAAATGG - Intronic