ID: 1136124640

View in Genome Browser
Species Human (GRCh38)
Location 16:28169091-28169113
Sequence CGTGAGGCCCTGAGGGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136124640_1136124648 13 Left 1136124640 16:28169091-28169113 CCCGGCACCCTCAGGGCCTCACG 0: 1
1: 0
2: 1
3: 28
4: 263
Right 1136124648 16:28169127-28169149 TACATGTCTCCCTAGCAAACAGG 0: 1
1: 0
2: 3
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136124640 Original CRISPR CGTGAGGCCCTGAGGGTGCC GGG (reversed) Intronic
900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG + Intronic
900391121 1:2434380-2434402 CCAGAGGCCCTGTGGGTGCCCGG - Intronic
900618397 1:3575928-3575950 GGTGAGGCCCGGAGTGGGCCTGG - Intronic
900661241 1:3785087-3785109 CTTGAGGTCCTGTGGGGGCCGGG + Exonic
901232726 1:7650160-7650182 CCTGAGGCTCTGACGCTGCCAGG + Intronic
902410223 1:16207841-16207863 CCTGAGGCCGTCAGGGTGCCTGG - Intronic
902767784 1:18628704-18628726 CCTGAGGTTCTGAGGGTCCCTGG + Intergenic
903693021 1:25187441-25187463 CCTGTGGACCTGAGGGTGCTGGG - Intergenic
903742100 1:25564176-25564198 CCTGAGTCCCTGAGGGAGTCAGG - Intronic
903785977 1:25861645-25861667 CCTAAGACCCTGAGGGTCCCAGG + Exonic
904875332 1:33650490-33650512 CGTGAGGCCCTGAAACTGCAAGG + Intronic
906208694 1:44000482-44000504 CCTGAGTCCCCGGGGGTGCCAGG + Intronic
906518336 1:46452657-46452679 CGGGAGGCCCAGAGGAGGCCAGG - Intergenic
907306171 1:53514277-53514299 AGTGAGGCCCCGAGGAGGCCTGG + Intronic
907338119 1:53713937-53713959 GGTGAGGCCCTCAGGGGGCCAGG - Intronic
907451213 1:54547151-54547173 CGAGAGGCCCTGAGGATGGAAGG + Intronic
912023569 1:105138445-105138467 CTTCAGCCCCTGAGGGTCCCAGG - Intergenic
913250740 1:116910336-116910358 CCTGGGGCGCCGAGGGTGCCCGG + Intronic
913592482 1:120342118-120342140 CGTGGGGGGCCGAGGGTGCCGGG + Intergenic
913650868 1:120913012-120913034 CGTGGGGGGCCGAGGGTGCCGGG - Intergenic
914170245 1:145216055-145216077 CGTGGGGGGCCGAGGGTGCCGGG + Intergenic
914525362 1:148460021-148460043 CGTGGGGGGCCGAGGGTGCCGGG + Intergenic
914598312 1:149175809-149175831 CGTGGGGGGCCGAGGGTGCCGGG - Intergenic
914641039 1:149607107-149607129 CGTGGGGGGCCGAGGGTGCCGGG - Intergenic
915941812 1:160123199-160123221 GGTGAGGCCCTGAGGGAGCAAGG - Exonic
918390214 1:184051850-184051872 CGTGGGCCCCTGAGGACGCCTGG + Exonic
919376784 1:196805059-196805081 AGAGAGGCCCTGAGAGTGACAGG + Intergenic
919386488 1:196929939-196929961 AGAGAGGCCCTGAGAGTGACAGG + Intronic
919389259 1:196961858-196961880 AGAGAGGCCCTGAGAGTGACAGG + Intergenic
919550104 1:198975186-198975208 CCTGAGGCCCTGAAGGGGACAGG + Intergenic
919776188 1:201195431-201195453 CGTGAGCCCCTGCGCCTGCCCGG + Intronic
919882140 1:201907742-201907764 TGTTGGGCCCTGTGGGTGCCAGG + Intronic
923034108 1:230272192-230272214 CGTGAGTGCCTGTGGGTGCTTGG + Intronic
923199044 1:231694162-231694184 CGTGTGGCCCTGGGAGTGCTGGG + Exonic
924754873 1:246931763-246931785 CGTGTGGCTCTGAGGTGGCCGGG - Intronic
1063056473 10:2510164-2510186 CATGAGGCCCTTGGTGTGCCAGG + Intergenic
1064562421 10:16606109-16606131 CGTGAGGCCTTCTGGGAGCCAGG + Intronic
1065828694 10:29595350-29595372 CGTGCTGCTCTGAGGGTGCCGGG - Intronic
1067047517 10:42992834-42992856 TGTGAGGCCCCAAGTGTGCCCGG + Intergenic
1067227230 10:44384205-44384227 TGTGAGGCTCGGAGGGTCCCTGG + Intronic
1067791295 10:49289693-49289715 GGTGGGGCCCTGCGGGAGCCAGG - Intergenic
1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG + Intronic
1069494276 10:68888928-68888950 TGTGAGCCACTGAGCGTGCCTGG + Intronic
1069724156 10:70566751-70566773 CGTGGGGCCCTGTGGGTGGGGGG - Exonic
1069848463 10:71389825-71389847 AGTGAGGCCCAGAGGGGGACAGG - Intergenic
1070170955 10:73932383-73932405 GGTAAGGCACTGAGGGTTCCAGG - Intergenic
1073696702 10:105877269-105877291 CATGATGCCCTGATAGTGCCTGG - Intergenic
1076541132 10:131215606-131215628 AGTTAGGCTCTGAGGATGCCTGG + Intronic
1076723687 10:132403841-132403863 GGGCAGGACCTGAGGGTGCCAGG + Intronic
1076741940 10:132490035-132490057 AGTGAGGCCGTGAGAGTCCCCGG - Intergenic
1077045334 11:542141-542163 TGTGGGGCACTGAGCGTGCCGGG - Intronic
1077045345 11:542180-542202 TGTGGGGCACTGAGCGTGCCGGG - Intronic
1077045356 11:542219-542241 TGTGGGGCACTGAGCGTGCCGGG - Intronic
1078105409 11:8355186-8355208 TCTGAGGCCTGGAGGGTGCCAGG + Intergenic
1081018957 11:37919319-37919341 CCTCAGGCTCTGAAGGTGCCAGG + Intergenic
1083581272 11:63827021-63827043 CTTGGTGCCCTGGGGGTGCCTGG - Exonic
1083591697 11:63899192-63899214 CATCAGGCCCTGAGTGTTCCAGG + Intronic
1083952747 11:65965900-65965922 GGTGAGGCCCTGCAGGTCCCGGG - Exonic
1084312341 11:68324399-68324421 TGTGTGGCCCCCAGGGTGCCCGG + Intronic
1085794335 11:79523702-79523724 CCTGACCCTCTGAGGGTGCCAGG - Intergenic
1089658673 11:119971327-119971349 CGTGAGGCCCTGCCCCTGCCTGG + Intergenic
1089746568 11:120621569-120621591 CATAAGCCCCTGAGGATGCCAGG - Intronic
1090611401 11:128474178-128474200 TCTGAGGTCTTGAGGGTGCCTGG - Intronic
1090660694 11:128879898-128879920 CCTGCGGCCCTCAGGGTCCCTGG - Intergenic
1091408010 12:220982-221004 AGTGAGGTCCTGGGGGTGGCGGG + Exonic
1096228385 12:49883676-49883698 CCTGAGACCCTGAGGGAGCAGGG + Intronic
1098244211 12:68499705-68499727 TGGGAGGCCCTGACTGTGCCAGG - Intergenic
1099202196 12:79690318-79690340 CCTGCGGCCCCGAGGATGCCAGG + Exonic
1100618509 12:96249937-96249959 CCTTAGGCAGTGAGGGTGCCTGG + Intronic
1102025277 12:109711142-109711164 CGACAGGCCCTGAGGGGGCAGGG - Intergenic
1102101366 12:110281324-110281346 CGTGCGGCGCTGAGGGACCCGGG + Intronic
1102952158 12:117038156-117038178 CGTGAGGAGCTGGGGGTCCCGGG + Intergenic
1103894905 12:124266535-124266557 CATGCGGCCCTGAGGGTCTCAGG + Intronic
1107450501 13:40504479-40504501 GGCAAGGCCCTGAGGGTGACAGG - Intergenic
1108310569 13:49185440-49185462 GGTGAGGAACTGAGGGTTCCTGG - Intronic
1113150457 13:107257663-107257685 CTGGAGGCCCTGAGGTGGCCAGG + Intronic
1113932349 13:113975044-113975066 CCTGAGGTCCTGAGGGTCACAGG + Intergenic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1118310061 14:64685571-64685593 CATGAGGCATGGAGGGTGCCAGG + Intergenic
1118571780 14:67201431-67201453 TGTGAGGCCCTGAGGGGAGCTGG - Intronic
1118729967 14:68659223-68659245 CGTGAGGCCCTGGGGCCGGCTGG + Intronic
1118732566 14:68678681-68678703 GGTGAGGCCGTGAGGGTTTCAGG + Intronic
1119346515 14:73929275-73929297 TGTGAGGCCCTCAGGGTTCCAGG + Intronic
1119655653 14:76414892-76414914 GATGAGGCCCTGAGAGGGCCGGG - Intronic
1121108562 14:91296527-91296549 CGTGGGGCCCTCAGGGTCCCAGG + Intronic
1121491099 14:94361740-94361762 CGAGAAGCCCTGAGAGTGCGTGG - Intergenic
1121492493 14:94370221-94370243 CGAGAAGCCCTGAGAGTGCGTGG - Intergenic
1122857934 14:104568868-104568890 AGGGAGGCCCTGAAGGTGCAGGG - Intronic
1122986462 14:105213935-105213957 CGGGAGGGCCTGAGAGCGCCTGG + Intronic
1123626096 15:22227761-22227783 CCTGAGGGCCTGGGGGTGTCAGG + Intergenic
1128417300 15:67458492-67458514 CAAGAGGCCCTGAGGGGGCAAGG - Intronic
1128752554 15:70159604-70159626 TGGGAGGCCCTGTGGGGGCCGGG - Intergenic
1130153720 15:81332263-81332285 GCTGAGGCCCTGAGGCTGACAGG - Exonic
1131108692 15:89751038-89751060 CGGGGGTCCCGGAGGGTGCCTGG + Exonic
1132653223 16:1030879-1030901 CATGGATCCCTGAGGGTGCCAGG - Intergenic
1132662606 16:1068314-1068336 TGTGAGGCTCAGTGGGTGCCGGG + Intergenic
1132848211 16:2010488-2010510 AGGGAGGTCCTGAGTGTGCCTGG - Intronic
1133317493 16:4893498-4893520 CCTGAGGCTCTGGGGGTACCGGG - Intronic
1135031835 16:19044831-19044853 GATGAGGCCCTCAGGGTGGCTGG - Intronic
1136019986 16:27434173-27434195 GGTGAGGCCCCCTGGGTGCCAGG + Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1136242722 16:28954425-28954447 CATGTGGCCCTGTGTGTGCCAGG + Intronic
1136419576 16:30123281-30123303 CGCGCGGCCCTGCGGGTGACAGG - Exonic
1136500007 16:30665334-30665356 CGGGAGGCCCGGAGGCAGCCCGG - Exonic
1137248145 16:46722097-46722119 TCTGAGGCCCTGAGGGAGTCTGG + Intronic
1139518164 16:67464089-67464111 CACAAGGCCCTGAGGCTGCCAGG - Intronic
1139719866 16:68843743-68843765 CGGGCGGCCCTGAGAGTCCCGGG - Intronic
1139851441 16:69953176-69953198 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139880418 16:70176088-70176110 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1140274180 16:73494054-73494076 CAAGAGGCCCTGAGGGAGACCGG - Intergenic
1140372092 16:74419429-74419451 CTAGAGGCCCGGAGGGTGCTCGG + Intronic
1140578432 16:76200061-76200083 GTTGAGGCCCTGAGGGTGTCAGG + Intergenic
1142040708 16:87892025-87892047 CGTGAGGCCTTCATGGTGCTTGG + Intronic
1142103618 16:88290122-88290144 AGTGAGGCACTTAGAGTGCCGGG + Intergenic
1142335837 16:89489699-89489721 CTTGGGGACCTGAGGCTGCCGGG - Intronic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1146352383 17:32105432-32105454 CCTGAGGCCCTGAGTGGACCTGG - Intergenic
1147257965 17:39193479-39193501 GGCCAGGCACTGAGGGTGCCGGG - Intronic
1150213376 17:63453778-63453800 CGTGAGCCCCAGGGGGTGCTTGG - Intergenic
1150267248 17:63839463-63839485 CCTGGGGCCCTGAGTGAGCCAGG - Intronic
1151718384 17:75842945-75842967 CCTGAGTCCCTGAGGGGGCTGGG + Intronic
1152028515 17:77827008-77827030 TCTGAGGCCCTGAAGGTCCCAGG - Intergenic
1152337285 17:79706171-79706193 CCTGGGGGTCTGAGGGTGCCAGG - Intergenic
1152570802 17:81120508-81120530 AGTGGGGCTCTGGGGGTGCCTGG + Exonic
1152625283 17:81385322-81385344 CGTGTGGCCCTAAGGCTCCCAGG + Intergenic
1156973349 18:43184900-43184922 CGTGAAGCACTGAGGCTGCCTGG - Intergenic
1158645398 18:59241295-59241317 AGTGAGGCACAGAGGGTGTCAGG - Intergenic
1160829208 19:1095112-1095134 CGGGAGGCCCAGAGGTCGCCGGG - Intronic
1161010191 19:1956111-1956133 CGAGAGGCCCTGCGGGAGCCAGG + Intronic
1161018766 19:1997688-1997710 CGTGAGGCCCTGTGTGGCCCAGG - Intronic
1161161349 19:2763274-2763296 AGTGAGGCCAGGAGGGTCCCCGG - Intronic
1161415881 19:4146019-4146041 CGTGACGCCCAGCGGATGCCCGG - Intergenic
1161925269 19:7294543-7294565 CGGGAGGCCCTGGGCGCGCCGGG + Intergenic
1162222411 19:9189128-9189150 CGTGGGGCCTTGAGGGTGATAGG + Intergenic
1162893058 19:13747917-13747939 CGTCACGCCCTGACCGTGCCCGG - Intronic
1163272653 19:16263446-16263468 AGTGAGGCTCTGAAGGTGCTGGG + Intergenic
1163683264 19:18695974-18695996 TGTCAGGCCCTGTGTGTGCCGGG + Intronic
1163719169 19:18890176-18890198 AGTGAGGGCCTGGAGGTGCCTGG - Intronic
1165431681 19:35776487-35776509 GGTGAGACCCTGAGGGTGACTGG + Intronic
1166786491 19:45370337-45370359 CCTGAGGACCTGAGGGTTACCGG - Intronic
1166861943 19:45816121-45816143 GATGAGGTCCTGAGGGGGCCGGG + Exonic
1167156188 19:47740814-47740836 CCTGAGGCCCTCAGGCTGCAAGG - Intronic
1167171615 19:47836172-47836194 TGTGAGGCCCTGAGGCTGGGTGG - Intronic
1167748244 19:51365429-51365451 CCTGAGGCCTCCAGGGTGCCAGG + Intronic
1168287018 19:55340192-55340214 GGAGAGGCCCTGAGGATGCAGGG - Intronic
1168287055 19:55340310-55340332 GGAGAGGCCCTGAGGGTGCAGGG - Intronic
925624351 2:5827162-5827184 GGTGTGGCCCTGAGGTTTCCAGG + Intergenic
925720209 2:6820250-6820272 GGTGAGACCCTGAGTGTCCCTGG + Intergenic
926789694 2:16557405-16557427 CGTGAGGGCCTGAGAGAGGCAGG - Intronic
928415143 2:31085634-31085656 CATGAGCCCCTGAGGGTGGAGGG - Intronic
929034968 2:37681835-37681857 GGTGAGTCCATGAGGGTGCTGGG + Intronic
929761546 2:44811305-44811327 CGTGTGGGCCTGAGGCTGACCGG - Intergenic
942268166 2:174248430-174248452 GGTGAGGCCCTCAGGGAGCCCGG - Exonic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
947156203 2:227164674-227164696 CCTGAGAGCCTGAGGGTCCCCGG + Exonic
947470575 2:230397798-230397820 CGTGAGTCCCTGAGTTGGCCGGG - Intronic
948772596 2:240259157-240259179 CCTGAGGCCCTGAGGGAGAATGG + Intergenic
948797890 2:240413939-240413961 CCAGAGACCCTCAGGGTGCCGGG + Intergenic
948808539 2:240463296-240463318 CCCGAGGCCCTGGGGGTGCCTGG - Intronic
948846912 2:240687644-240687666 GGTGCGGTCCTGAGGGCGCCTGG - Intergenic
1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG + Intronic
1170627626 20:18041734-18041756 AGAGAGGCCATGAGGGTCCCCGG + Intronic
1170889129 20:20364448-20364470 CGGGAGGCCCGGAAGGTGCCTGG + Intergenic
1172105755 20:32516449-32516471 CGTGAGGCCATTAGGGTCACTGG + Intronic
1172965469 20:38831287-38831309 CGTGAGACCCAGAGGGTGATGGG - Intronic
1173521540 20:43703698-43703720 AGCGAGGCCCTGAGGTGGCCTGG + Intronic
1174390716 20:50216831-50216853 CTGGGGGCCATGAGGGTGCCTGG + Intergenic
1174581255 20:51573534-51573556 CCTTAGGCTCTGTGGGTGCCTGG + Intergenic
1175690979 20:61065870-61065892 CACGAGGCCTTGAGGGCGCCGGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175893125 20:62324037-62324059 GACGAGGCCCTGATGGTGCCAGG - Intronic
1176008050 20:62876842-62876864 CTTGTGGGCCTGTGGGTGCCAGG + Intergenic
1176111793 20:63414214-63414236 CGTGAGGGGCCGAGGGGGCCGGG + Intronic
1179876247 21:44269876-44269898 TGTGAGCCCCTGTGTGTGCCTGG - Intergenic
1180127571 21:45802690-45802712 GGAGAGGCCCTGAGGGAGGCAGG + Intronic
1181484272 22:23220556-23220578 TCTGAGGCCCTGAGGCTGCCTGG + Intronic
1182662400 22:31934185-31934207 CACCAGGCCCTGAGGGAGCCAGG - Exonic
1183678210 22:39311621-39311643 CCTGTGGACCTGAGGGTGCAGGG - Intergenic
1184797597 22:46740983-46741005 AGTGAGGCCCTGTGGCAGCCGGG - Intergenic
1185007316 22:48288739-48288761 CAGGAGGCCCTGAGGACGCCCGG - Intergenic
1185042364 22:48511696-48511718 CGTCAGGGCCTGTGTGTGCCGGG - Intronic
1185263883 22:49887282-49887304 AGAGCGGCCCTGAGAGTGCCTGG - Exonic
1185300094 22:50075089-50075111 GTTGCGGCCCTGATGGTGCCGGG - Intronic
950459886 3:13115012-13115034 GGGGAGGCCCTGGAGGTGCCGGG + Intergenic
950471076 3:13186793-13186815 CCTGAGTCCCTGACGGAGCCTGG - Intergenic
950765478 3:15269999-15270021 TATGAGGACCTGTGGGTGCCAGG - Intronic
953659406 3:44880613-44880635 GGTGAGGTCCTGAGGGAGCTAGG + Intronic
953926648 3:46985970-46985992 CGGGAGTCCCTCAGGGAGCCAGG - Intronic
954432668 3:50479556-50479578 ACAGAGGCCCTGAGGGGGCCAGG + Intronic
954773917 3:52999185-52999207 CGTGAGGTCCTTGGGCTGCCCGG - Intronic
954806804 3:53225316-53225338 GGGGCGGCCCTGAGAGTGCCTGG + Intronic
961633890 3:128321074-128321096 TGGGAGGCCCTGGGGGTGCCAGG + Intronic
961773604 3:129268148-129268170 CATGATGCCATGAGGTTGCCAGG - Intronic
962755897 3:138465220-138465242 CTTGAGGCACTGAGGGGGTCAGG + Intronic
963061160 3:141228144-141228166 CCTGAGGCCCTGCAGTTGCCAGG + Intergenic
963071184 3:141306668-141306690 AGGGAGGCCCTTAGGGAGCCTGG - Intergenic
963702722 3:148645995-148646017 TGGGAGGCCCTGGGGGAGCCAGG - Intergenic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
967037082 3:185656008-185656030 AGTGAGGCTCAGAGAGTGCCGGG - Intronic
967099133 3:186201417-186201439 CATGTGGCAGTGAGGGTGCCAGG - Intronic
968516961 4:1019466-1019488 CGGGAGGCCCTGTGGGTGGTGGG + Intronic
968612565 4:1563859-1563881 GGTGCAGCCCTGAGGGTGGCCGG - Intergenic
968661962 4:1802354-1802376 TCTGAGGCCCAGAGGGGGCCTGG - Intronic
969218973 4:5747029-5747051 GGTGAGAGCCTGAGGGTGTCAGG + Intronic
970441285 4:16083143-16083165 CGTGAGGCGCTGAGCTTCCCTGG - Intronic
972270230 4:37503333-37503355 GGGAAGGCACTGAGGGTGCCTGG - Intronic
972601487 4:40576685-40576707 CCTGAGCCCCTCAGGGTGCTGGG + Intronic
981685909 4:147454706-147454728 CCTGATGCACTGAGGGTGCAAGG - Intergenic
984778556 4:183504782-183504804 CGTGAGGCACGGAGGGTGACTGG + Intergenic
986284187 5:6347849-6347871 CGTGAGGGCCTGGGGGGCCCAGG + Intergenic
986450000 5:7853952-7853974 TGTGAGGCCCTGAGGATGCAGGG + Intronic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
989103405 5:37840009-37840031 CGTGAAGACATGAGGGCGCCAGG + Intergenic
995142405 5:108748843-108748865 GCTGAGGCCTCGAGGGTGCCCGG + Intronic
995526018 5:113051183-113051205 CGTGGGGCCCTGAGGATCCTGGG - Intronic
995589156 5:113680599-113680621 ACTGAGACACTGAGGGTGCCAGG + Intergenic
997135314 5:131319220-131319242 AGTGAGGCACTGAGGGTGGGGGG - Intronic
1001276210 5:170353606-170353628 CGGGAGGACCTCAGGATGCCAGG - Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1001678254 5:173536338-173536360 GGAGGAGCCCTGAGGGTGCCAGG - Intergenic
1002026250 5:176397798-176397820 GGTGCGGCCCTGTGGCTGCCTGG - Intronic
1005598978 6:27407073-27407095 CTTCAGCCCCTGAGGGTTCCTGG - Intergenic
1005822752 6:29611116-29611138 CCTGAGGCCCTAAGGATGCTTGG + Intronic
1006063173 6:31441152-31441174 TGTGTGGCCCTGAGGCTCCCGGG + Intergenic
1006535441 6:34696009-34696031 AGTGAGGGGCTGAGGATGCCAGG - Intronic
1007040306 6:38715460-38715482 CGGGAGGCCCTGATGCAGCCGGG + Intronic
1007369839 6:41419479-41419501 AGAGAGGCCCTGAGGATGCCTGG + Intergenic
1009479958 6:64144477-64144499 AGTGAGGCCCAGAGTGTGCTTGG + Intronic
1015430856 6:133129214-133129236 GGTGAGGTCCTGTGGGTCCCTGG - Intergenic
1015514600 6:134071575-134071597 CATGGGGCCCTGGAGGTGCCAGG + Intergenic
1018178044 6:161196016-161196038 CTAGAGCCCCTGAAGGTGCCAGG + Intronic
1018323024 6:162633700-162633722 CGTGGGACCCTGAATGTGCCTGG + Intronic
1018754658 6:166838701-166838723 GGTGAGGCCTTGAGGATACCTGG - Intronic
1018784604 6:167098409-167098431 CGTGGGGTCCTGTGGATGCCCGG + Intergenic
1018918126 6:168150699-168150721 CGTGAGGCCCCTAGAGTCCCCGG + Intergenic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019266620 7:120799-120821 CCAGAGGCCCTGAGGGGTCCGGG - Intergenic
1019275823 7:175117-175139 CATGAGGCCCACAGAGTGCCTGG - Intergenic
1019421410 7:952961-952983 TGGGAGGCCCAGAGGGTGGCTGG + Intronic
1019485641 7:1288091-1288113 CCTGGGCCCCTGAGGGTGGCAGG - Intergenic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1019756488 7:2774486-2774508 TGGGAGGCCCTGAGTGTGCAGGG + Intronic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1029159305 7:98540553-98540575 CCTGGGGCCCTGGGGCTGCCTGG + Intergenic
1029259710 7:99293529-99293551 GGAGGGGCCCTGAGGGTGTCTGG - Intergenic
1032020081 7:128402631-128402653 CCAGAGGGCCTGAGTGTGCCTGG - Intronic
1035153429 7:156893322-156893344 CGGGAGGCGCTGAGGGGGCGGGG + Intergenic
1035664830 8:1373271-1373293 CGTGCGGCCCGGAGGGTGTCGGG + Intergenic
1035680350 8:1483184-1483206 TGAGAGGCCCTGAGGGGTCCAGG + Intergenic
1036041543 8:5087789-5087811 CGAGAGGACAAGAGGGTGCCAGG + Intergenic
1036669021 8:10767746-10767768 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1036669028 8:10767785-10767807 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1036669035 8:10767824-10767846 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1036669049 8:10767900-10767922 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1036669056 8:10767939-10767961 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1036669063 8:10767978-10768000 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1036669070 8:10768017-10768039 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1036669090 8:10768134-10768156 TGTGTGGCTGTGAGGGTGCCTGG - Intronic
1038440644 8:27568965-27568987 TGTGAGGCCCACAGGGTGCATGG + Intergenic
1039311565 8:36322363-36322385 GGAGAGGCCCTGAGGGAGCCTGG - Intergenic
1041262837 8:56036657-56036679 CGTCATGGCCTGAGGGTGCCTGG - Intergenic
1044198683 8:89409020-89409042 TCTGAAGCCCTGAGGGAGCCAGG - Intergenic
1047251677 8:123185669-123185691 GGTGAACCCCTGAGGGTCCCAGG - Intronic
1048272838 8:133043244-133043266 CATGAGGCCATGAGGCTACCAGG - Intronic
1048329143 8:133460494-133460516 CTAGTGGCCCTGAGGGCGCCTGG - Intronic
1048794946 8:138141237-138141259 GGTGAGGCCCAGAGAGTGACAGG + Exonic
1049064504 8:140302220-140302242 CGTGAGTCACTGAGGGTGGTGGG - Intronic
1049434601 8:142580544-142580566 TCAGAGGGCCTGAGGGTGCCTGG - Intergenic
1049692118 8:143966020-143966042 CAGGAGGCCCTGCTGGTGCCAGG - Intronic
1049849131 8:144821401-144821423 TGAGAGGCACTGGGGGTGCCTGG - Intergenic
1049849999 8:144826046-144826068 TGTGAGGGCCTGAGTGTGCCTGG + Intergenic
1055728492 9:79257349-79257371 CGTGAGGCCCTAAGAGTGAAGGG - Intergenic
1056246101 9:84697059-84697081 CGTCAGTCCCTCAGGGTCCCTGG - Intronic
1056659754 9:88535141-88535163 CCTGAGGGCTTGAGGTTGCCTGG + Exonic
1057146041 9:92760194-92760216 CCTGGGCCCCTGGGGGTGCCTGG - Intronic
1059760757 9:117335100-117335122 AGTGAGCCCCTGGGGGTGCAAGG - Intronic
1060055135 9:120406753-120406775 CCAGAGGCACTGAGGGTGTCTGG + Intronic
1060300020 9:122369718-122369740 CCTGGGGCTCTCAGGGTGCCGGG - Intergenic
1060554660 9:124502011-124502033 AGCCAGGCCCTGAGGGGGCCGGG - Intronic
1060794883 9:126506774-126506796 CGGGCCACCCTGAGGGTGCCAGG - Exonic
1060982893 9:127803667-127803689 CTTGAGGTCCTGAGGGTGGGAGG + Intronic
1061405255 9:130390274-130390296 TGTGAGCCCCTGATGGAGCCGGG - Intronic
1061498774 9:130990531-130990553 CATGGGGCCCTGAGGGGGACAGG - Intergenic
1061858287 9:133455050-133455072 AGAGAGGCCGTGAGGGTGACAGG + Intronic
1061949868 9:133930234-133930256 CGGGAGGCAGTGAGGATGCCGGG - Intronic
1062468387 9:136691556-136691578 ACGGAGGCCCAGAGGGTGCCTGG + Intergenic
1189446353 X:41085166-41085188 CGCGAGCCGCTGAGGGGGCCGGG - Intergenic
1192209894 X:69121337-69121359 CCTGAGTCTCTGAGGGAGCCTGG + Intergenic
1192639340 X:72847520-72847542 GCTGAGGCCCTGAGAGTGGCAGG + Intronic
1192642371 X:72873285-72873307 GCTGAGGCCCTGAGAGTGGCAGG - Intronic
1199708683 X:150452472-150452494 CTTGAGGGCCTGAGGGTGGAGGG + Intronic
1200063051 X:153492080-153492102 CCTGAGGCCCTCAGGGATCCTGG - Intronic
1200235513 X:154466084-154466106 AGTGCGGCTCTGTGGGTGCCCGG + Intronic