ID: 1136125796

View in Genome Browser
Species Human (GRCh38)
Location 16:28179471-28179493
Sequence GTCAAACCAGACTGGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136125791_1136125796 19 Left 1136125791 16:28179429-28179451 CCTAATAATTAAGCAAAGGTTTC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1136125796 16:28179471-28179493 GTCAAACCAGACTGGAACTGAGG 0: 1
1: 0
2: 0
3: 5
4: 123
1136125790_1136125796 20 Left 1136125790 16:28179428-28179450 CCCTAATAATTAAGCAAAGGTTT 0: 1
1: 0
2: 0
3: 16
4: 250
Right 1136125796 16:28179471-28179493 GTCAAACCAGACTGGAACTGAGG 0: 1
1: 0
2: 0
3: 5
4: 123
1136125788_1136125796 24 Left 1136125788 16:28179424-28179446 CCTGCCCTAATAATTAAGCAAAG 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1136125796 16:28179471-28179493 GTCAAACCAGACTGGAACTGAGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136125796 Original CRISPR GTCAAACCAGACTGGAACTG AGG Intronic
900852541 1:5155336-5155358 GTCAAACTAGAATTGAACTAAGG - Intergenic
904791701 1:33027186-33027208 GAAAAACCAGGCTGGCACTGTGG + Intronic
905188486 1:36214503-36214525 GGCAAACCAGAGTGAAAGTGGGG - Intergenic
905831344 1:41071039-41071061 GTCAAAGCAGACTTAAACTATGG - Intronic
906417037 1:45628345-45628367 GGGAGAACAGACTGGAACTGCGG + Exonic
906710684 1:47927522-47927544 GTCTAACCAGGCTGCAAGTGAGG + Intronic
909225909 1:73022602-73022624 GTGAAACCAGATTGAAACTCAGG + Intergenic
910768832 1:90810250-90810272 GTCAAACCAGACTGGCATCCTGG + Intergenic
910910620 1:92230252-92230274 GCCAAACCAGTCTTGAACTCTGG - Intronic
913609834 1:120500295-120500317 GTCACAGCAGGCTGGAACAGAGG - Intergenic
914581357 1:149021946-149021968 GTCACAGCAGGCTGGAACAGAGG + Intronic
919617229 1:199822817-199822839 GAGAGACCAGACTGGAATTGTGG - Intergenic
920844657 1:209583894-209583916 GTCAGGGAAGACTGGAACTGGGG - Exonic
924294304 1:242569937-242569959 GTCATACCAGCCTGTAACTTTGG + Intergenic
1062845757 10:703712-703734 GTCAGCCCAGACTCGAGCTGAGG + Intergenic
1065046826 10:21753103-21753125 GTGAGACCTGACTGGAGCTGGGG - Intergenic
1069616469 10:69809664-69809686 GTCAAACCAGCCAGGGGCTGGGG + Intronic
1070604542 10:77889512-77889534 GTCAACCCAGTCGGGGACTGTGG + Intronic
1072552704 10:96491440-96491462 GTCAGTCAAGACTGGAGCTGAGG - Intronic
1073417085 10:103393292-103393314 GTAAAACCAGCCTGGCACGGTGG + Intronic
1074249765 10:111732783-111732805 GTTTAACCAGAGTAGAACTGTGG - Intergenic
1074410713 10:113226046-113226068 GTTAAACCAGGCTGGAAGCGAGG + Intergenic
1077148237 11:1055427-1055449 CTCTAACCAGACAGGAGCTGGGG - Intergenic
1078465381 11:11546281-11546303 GTCAACCCAGCCAGGACCTGAGG + Intronic
1078467768 11:11562837-11562859 GGCAAAAAAGACTTGAACTGGGG + Intronic
1078476553 11:11635189-11635211 GTGAAGCCAGAAAGGAACTGGGG - Intergenic
1078884473 11:15486265-15486287 ATCAAACCAGGCTGGAAATTGGG - Intergenic
1081303346 11:41480725-41480747 GTCAAACCATTCTGAAAATGAGG - Intergenic
1081617074 11:44597389-44597411 GTGAACCAAGACTGGAGCTGTGG - Intronic
1083259853 11:61517044-61517066 GCCCATCCAGAGTGGAACTGGGG + Intronic
1085255789 11:75172241-75172263 GGCAGAGCAGACTGGAACTCAGG + Intronic
1085936331 11:81150169-81150191 CTCAACCCAGCCTGAAACTGCGG - Intergenic
1090807569 11:130211961-130211983 GTCAAGCCACAATGGAGCTGAGG - Intergenic
1091508576 12:1098426-1098448 TGCAAACTAGACTGGAAATGGGG + Intronic
1094142996 12:27199813-27199835 GTCAAACCCAACAGGAGCTGTGG - Intergenic
1094752160 12:33423238-33423260 GTCCCAACAGACTGGAGCTGGGG + Intronic
1096339487 12:50785590-50785612 CTCACACCAAACTGCAACTGAGG + Intronic
1097277583 12:57823842-57823864 GAGGAAGCAGACTGGAACTGTGG - Intronic
1098392635 12:69985773-69985795 GTCAATCCAGGGTGGGACTGTGG + Intergenic
1100606216 12:96154156-96154178 GTCCAAGCTGAGTGGAACTGAGG - Intergenic
1101696162 12:107129334-107129356 AGCAAAGCATACTGGAACTGAGG - Intergenic
1102052664 12:109874198-109874220 GTAAAGCCAGACTAGAACTTGGG - Intronic
1102738290 12:115182595-115182617 TTCAAACTAGACTGGAAATCAGG + Intergenic
1111034299 13:82651226-82651248 GTTAAACCATACTGGAACCATGG + Intergenic
1114626013 14:24130924-24130946 CTCAATCCAGACAGGAACTAGGG + Intronic
1118391909 14:65302954-65302976 GTCCAGTCAGACTGAAACTGGGG + Intergenic
1126209927 15:46090375-46090397 GTTAAACCTGAGTGGATCTGAGG - Intergenic
1129167691 15:73788121-73788143 ATCAAAGCAGGCTGGAAGTGCGG + Intergenic
1130474643 15:84253688-84253710 GTCAAAACAGTTTGGACCTGGGG + Intergenic
1130482059 15:84367742-84367764 GTCAAAACAGTTTGGACCTGGGG + Intergenic
1130586136 15:85184408-85184430 GTCAAAACAGTTTGGACCTGGGG + Intergenic
1131891978 15:96982894-96982916 GTCACTCCAGTTTGGAACTGAGG - Intergenic
1132771031 16:1563543-1563565 GTCAGACCAGACAGTAAGTGTGG + Intronic
1135324490 16:21517697-21517719 TTCAAACCAGCCAGGCACTGTGG - Intergenic
1135535247 16:23288892-23288914 CAAAAACCAGACAGGAACTGAGG - Intronic
1135909718 16:26548416-26548438 GTCAAAACTGAATAGAACTGTGG + Intergenic
1136125796 16:28179471-28179493 GTCAAACCAGACTGGAACTGAGG + Intronic
1136335973 16:29610962-29610984 TTCAAACCAGCCAGGCACTGTGG - Intergenic
1142036691 16:87866751-87866773 TTCAAACCAGCCAGGCACTGTGG - Intronic
1143900660 17:10172255-10172277 GTCAACCAGGACTGGACCTGAGG - Intronic
1149592027 17:57837218-57837240 GTTAAACCAGACTGGGACTCTGG - Exonic
1152784104 17:82239152-82239174 GTCATTCCAGAGTGGATCTGCGG + Exonic
1153266711 18:3278099-3278121 GTATAATCAGACTGGAAATGGGG + Exonic
1156895597 18:42241861-42241883 GCCAACCCAGACTGGAACCCAGG - Intergenic
1158224014 18:55181988-55182010 GTCAAGCCAGCTTGGAACTGAGG - Intergenic
1159439057 18:68454652-68454674 AACAAACAAGACTGGAGCTGGGG + Intergenic
1160222640 18:76988603-76988625 GTCAAAGCACAGTGGAGCTGAGG + Intronic
1168575750 19:57507370-57507392 GTTTAACAAGACTGGAGCTGTGG - Exonic
926537492 2:14131260-14131282 GTCTACCCAGCCTGGAACTGTGG - Intergenic
928414979 2:31084598-31084620 GTCAAACAAGACTGGAATAATGG + Intronic
928824598 2:35404792-35404814 GTCAAACAAGCCTGGATTTGAGG + Intergenic
930720554 2:54633621-54633643 TTCAACCCAAACTGGAACAGGGG - Intronic
931462701 2:62462344-62462366 GTCACACAAGGCTGGAACTTGGG - Intergenic
934568478 2:95353476-95353498 GCCAAACCGGGCTGGAACGGAGG - Intronic
940842776 2:158603855-158603877 TTCAAACAAGACTTGAATTGAGG + Intronic
945512188 2:210716400-210716422 CTCAAACAAGACTGGAAAGGTGG - Intergenic
947778335 2:232733301-232733323 TGCAAACCAGACTAAAACTGAGG - Intronic
1169649835 20:7854744-7854766 GTCTAGCCAGACTGGCAATGTGG - Intergenic
1173438624 20:43055518-43055540 GACAAAGCAAACTGGAAATGAGG + Intronic
1175301007 20:57942636-57942658 GGAAAACCAGACTGGAGCAGAGG - Intergenic
1178232775 21:30805777-30805799 GTAAAATCAGATTTGAACTGTGG + Intergenic
1178235323 21:30835005-30835027 GGCAAAGCTGACTGGACCTGGGG - Intergenic
1184352212 22:43951900-43951922 GCCACCCCAGCCTGGAACTGGGG + Intronic
1185200341 22:49498782-49498804 GGCCAATCAGACTGGAACGGAGG + Intronic
953858268 3:46518568-46518590 GCCAAACCAGCCTCGAACTCCGG + Exonic
965910835 3:173773220-173773242 CTCATACCAGACTGGAAGTGAGG + Intronic
968627661 4:1634463-1634485 GTGAAACCAGATGGGAACAGGGG - Intronic
968694384 4:2015417-2015439 GTCAAGCCATATTGGAGCTGAGG + Intronic
968708094 4:2092942-2092964 GTCAAGCCAGACCGGAACAATGG + Intronic
969247097 4:5942242-5942264 AGCAAACCAGATTGGCACTGTGG - Intronic
969394909 4:6914248-6914270 GGCAAACCAGGCAGAAACTGCGG - Intronic
973805437 4:54521637-54521659 GTCAAACCAGTGAGTAACTGTGG + Intergenic
975822930 4:78290041-78290063 GTCCCACCAGAGTGGAACAGAGG - Intronic
976124118 4:81815318-81815340 GTCATACCAGAGGAGAACTGAGG + Intronic
981406659 4:144378409-144378431 TTCAAATCATACTGGAGCTGTGG + Intergenic
986598983 5:9452285-9452307 GTCAAAGCAAATTGGAATTGAGG - Intronic
987214334 5:15717305-15717327 GCCAAACCAGACTGACAATGTGG - Intronic
993126138 5:83838061-83838083 GTCAAAACAACCTGGAAATGTGG + Intergenic
994332847 5:98527459-98527481 TTCAAGCCAGACTGGGTCTGTGG - Intergenic
999728663 5:154458670-154458692 ACCATACCAGGCTGGAACTGAGG - Exonic
999825026 5:155265599-155265621 TGCAAACCAGACTGGCCCTGAGG - Intergenic
999968747 5:156837704-156837726 GTAAAACCAGCCAGGAACAGTGG - Intergenic
1001499051 5:172214321-172214343 GGCAGACCAGATTGGACCTGTGG - Intronic
1007720529 6:43882596-43882618 GGAAAACCAGATGGGAACTGTGG - Intergenic
1012866240 6:104621831-104621853 ATCAAACCATAGTGGAACTGGGG + Intergenic
1014299118 6:119658583-119658605 GCTAATACAGACTGGAACTGAGG - Intergenic
1015607337 6:134971952-134971974 GCAAAACCAGACTTGAAGTGAGG + Intronic
1022464912 7:30647082-30647104 AGAACACCAGACTGGAACTGGGG + Intergenic
1022599982 7:31748810-31748832 GTCAAATTAGGTTGGAACTGGGG - Intergenic
1023143201 7:37122948-37122970 GTGCAACCAAACTGGAACTCAGG + Intronic
1028295993 7:89132375-89132397 AGAAAACCAGACTGGAAGTGAGG + Intronic
1037401674 8:18500453-18500475 ATGAAACCAGCCTGGAAGTGGGG + Intergenic
1038584647 8:28778004-28778026 GCCAAGCCAGACAGCAACTGGGG + Intronic
1039608077 8:38899323-38899345 AGCAAATCCGACTGGAACTGAGG - Intergenic
1043268728 8:78301415-78301437 GTCTGACCAGAGTGGAAGTGAGG - Intergenic
1049751255 8:144285315-144285337 ATCACATCAGACTGGAACAGTGG - Intronic
1055282890 9:74695196-74695218 ATCAAACCAGACTGGAAGGTTGG - Intergenic
1056200552 9:84271709-84271731 GTCAAATCAGACTGCGACGGAGG + Intergenic
1060032904 9:120231027-120231049 GCCAAACCAGACTGGACCATGGG + Intergenic
1061522807 9:131130800-131130822 GGGAAAACAGAATGGAACTGTGG + Exonic
1062681822 9:137786224-137786246 GTCTGACCAGTCTGGAACTTCGG + Intronic
1187808555 X:23149172-23149194 GTCAGCCCAGATTTGAACTGTGG + Intergenic
1189319080 X:40076481-40076503 CAAAAGCCAGACTGGAACTGAGG - Exonic
1189776332 X:44473163-44473185 GAAAAACAAAACTGGAACTGTGG - Intergenic
1190463518 X:50703078-50703100 CTCAAAGCAGACAGGAACAGTGG - Intronic
1195584579 X:106551028-106551050 AACAAACCACACTGTAACTGTGG + Intergenic
1196839860 X:119849584-119849606 GATAAACCAGACTGAAACAGAGG + Intronic
1202376345 Y:24241183-24241205 GTCAAAACAGTTTGGACCTGGGG - Intergenic
1202494435 Y:25428936-25428958 GTCAAAACAGTTTGGACCTGGGG + Intergenic