ID: 1136126844

View in Genome Browser
Species Human (GRCh38)
Location 16:28189480-28189502
Sequence GTCCTATCACAGTCAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136126844_1136126849 8 Left 1136126844 16:28189480-28189502 CCTTAGCCTGACTGTGATAGGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1136126849 16:28189511-28189533 GCCAAGCAGAGGGAAGACCGAGG 0: 1
1: 0
2: 2
3: 39
4: 242
1136126844_1136126848 -2 Left 1136126844 16:28189480-28189502 CCTTAGCCTGACTGTGATAGGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1136126848 16:28189501-28189523 ACAGCGTAAGGCCAAGCAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 131
1136126844_1136126847 -3 Left 1136126844 16:28189480-28189502 CCTTAGCCTGACTGTGATAGGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1136126847 16:28189500-28189522 GACAGCGTAAGGCCAAGCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136126844 Original CRISPR GTCCTATCACAGTCAGGCTA AGG (reversed) Intronic
902992597 1:20199645-20199667 GTCCCTTCACATTCAGGCAAAGG + Intergenic
903129860 1:21271847-21271869 GCCCGATCACCGTGAGGCTAAGG + Intronic
904480001 1:30787670-30787692 GTCCTGCCACAGGCAGGCCATGG - Intergenic
906286871 1:44593239-44593261 GTCCTATCACAGTCCTGATAAGG + Intronic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
1065484123 10:26220494-26220516 TTTCTATCAAAGTCAGGCTATGG + Intronic
1070307788 10:75250153-75250175 GTCCTATCATAGTCTGACCATGG + Intergenic
1071102600 10:82056371-82056393 TTCCTATCAGAGTGAGCCTATGG - Intronic
1073157792 10:101361706-101361728 GCTCTATCTCAATCAGGCTATGG - Intronic
1077941058 11:6844023-6844045 GACCTGTCAAAGACAGGCTAGGG - Intergenic
1080050940 11:27858311-27858333 GTCCTAGCACAGTCAGGCATGGG - Intergenic
1080934262 11:36845516-36845538 TTCCTATCACTCTGAGGCTATGG - Intergenic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089695931 11:120216343-120216365 GTGCTAACACAGACAGGGTAGGG - Intronic
1090370604 11:126248862-126248884 GGCATTTCACAGACAGGCTAGGG + Intronic
1093595156 12:20950618-20950640 TGCCCATCACAGTCATGCTATGG + Intergenic
1104096125 12:125559683-125559705 GTCCTATTACTTTCAGGGTAGGG + Intronic
1104278443 12:127352141-127352163 GTCCTATTACTTTCAGGGTAGGG - Intergenic
1104586509 12:130052353-130052375 CACCTATTACAGGCAGGCTAGGG - Intergenic
1110525677 13:76533826-76533848 GTTCTATCACAGCCAGGTTTTGG - Intergenic
1114234014 14:20808842-20808864 GTCCTATCACCAACAGGTTAAGG + Intergenic
1133885447 16:9823320-9823342 GTTCTATCACATACAAGCTATGG + Intronic
1136126844 16:28189480-28189502 GTCCTATCACAGTCAGGCTAAGG - Intronic
1137861287 16:51849275-51849297 TTCCTCTCTCACTCAGGCTAGGG - Intergenic
1139317283 16:66084155-66084177 GTCCTGTCAGTGTCTGGCTACGG - Intergenic
1140723294 16:77789562-77789584 TTCCTTTCCCCGTCAGGCTACGG - Intronic
1141750930 16:85957395-85957417 GGCCTTGCACAGTCAGGCCACGG + Intergenic
1149037978 17:52156957-52156979 GTCCTAACACACTCAGGCACAGG + Intronic
1149485861 17:57042237-57042259 GTCCTAACACATCCAGTCTAGGG - Intergenic
1150432457 17:65129267-65129289 ATCCCGTCACAGTCAGGCAAGGG + Intergenic
1164833892 19:31344621-31344643 GTCCTGCCAGAGTCAGGCTGGGG - Intronic
1165299607 19:34960498-34960520 TTCCTGGCACAGTCAGGCTTAGG + Intronic
1168646175 19:58060357-58060379 GTCCTTTCAGAGGCAGGCTGTGG - Intronic
925059721 2:881534-881556 CTCCTGTCACACCCAGGCTAGGG - Intergenic
925183453 2:1831549-1831571 GTCCTATCTCAGTCTGGTTTTGG + Intronic
925729895 2:6911845-6911867 GCCCCCTCACAGTCAGGCCAGGG - Intergenic
928481968 2:31692413-31692435 TGCCCATCACAGTCATGCTATGG + Intergenic
929023142 2:37574251-37574273 GTCCTAGCCCAGTCAAGCTATGG - Intergenic
931934416 2:67180332-67180354 TTCATATAAGAGTCAGGCTAGGG - Intergenic
934933921 2:98451087-98451109 TTCCAATCCCAGACAGGCTATGG - Intronic
935039927 2:99416444-99416466 GTTCTATAACAGTCAGGTTAAGG + Intronic
937536243 2:122891496-122891518 GTGCTAGCACAGTCAGGTTTTGG - Intergenic
939184710 2:138846569-138846591 GTACTATAACAGTCAGGATAAGG - Intergenic
941426645 2:165354566-165354588 GTACTGTCACAGTGAGGCTAGGG - Exonic
946814812 2:223565956-223565978 GTCCTTTTTGAGTCAGGCTAAGG - Intergenic
948681671 2:239639369-239639391 GTCCAATCACAGTCATGGTCTGG - Intergenic
1170012690 20:11743783-11743805 CTCCTCTCACAGTAAGTCTAAGG + Intergenic
1175756233 20:61532123-61532145 GTCCTCACACAGTCAGGACACGG - Intronic
1177811196 21:25926433-25926455 GTCCCATCACAGTATGGCTTTGG - Intronic
950791583 3:15476659-15476681 CTCCTTCCTCAGTCAGGCTATGG - Intronic
954435012 3:50491337-50491359 AGACTATCACAGTGAGGCTAAGG + Intronic
958062366 3:88499442-88499464 GGCTTTTCAAAGTCAGGCTATGG + Intergenic
975702334 4:77078075-77078097 ATCCCATCACTTTCAGGCTAAGG - Intergenic
986235425 5:5905264-5905286 ATCCTATACCAGTCAGGATAGGG + Intergenic
988914964 5:35883107-35883129 GTCATATGACAGCCAGACTAGGG - Intergenic
996718148 5:126604075-126604097 GACCTGTCAAAGACAGGCTAGGG + Exonic
1008070395 6:47093502-47093524 TTGCTATCACAGGCAAGCTAAGG - Intergenic
1009828288 6:68897023-68897045 GTCCTATTGTAGTCATGCTAAGG + Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1034538682 7:151742214-151742236 GTCCTATGGGATTCAGGCTAGGG - Intronic
1038469361 8:27799825-27799847 ATACTATTAAAGTCAGGCTAAGG + Intronic
1041603078 8:59745155-59745177 CTACTTGCACAGTCAGGCTATGG - Intergenic
1053466196 9:38310428-38310450 TTCTTATCAAAGCCAGGCTAGGG - Intergenic
1053613890 9:39744049-39744071 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1053871924 9:42502006-42502028 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1053900825 9:42793971-42793993 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1054239626 9:62598348-62598370 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1054260825 9:62863575-62863597 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1054553759 9:66632875-66632897 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1059949666 9:119449144-119449166 ATCCTATCACATTGAGGCTTAGG - Intergenic
1060725245 9:126001997-126002019 GTCCTTTCACATTCGGGCTGTGG + Intergenic
1186676212 X:11820076-11820098 GGCCTTTTACAGTCAGACTAAGG - Intergenic
1188481208 X:30638681-30638703 CTCCTAATACAGTCAGGCTACGG + Intergenic
1192600903 X:72462705-72462727 GTCCTGTCACAGTCACCCAACGG + Intronic
1193170701 X:78332446-78332468 CTCCTATGACAGTCAGTCTTTGG - Intergenic
1200476819 Y:3648822-3648844 TTCCCCTCACAGTCATGCTAAGG + Intergenic
1201890797 Y:18941782-18941804 GAACTATGACAGTCAGGCAAAGG + Intergenic
1201935476 Y:19406884-19406906 GTGCTGTCACAGTCTGGCTTGGG - Intergenic