ID: 1136127071

View in Genome Browser
Species Human (GRCh38)
Location 16:28191742-28191764
Sequence GAGCTGGCTTTACCTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136127068_1136127071 1 Left 1136127068 16:28191718-28191740 CCAAGGGTTTTAAGGATGATGAA 0: 1
1: 0
2: 1
3: 14
4: 442
Right 1136127071 16:28191742-28191764 GAGCTGGCTTTACCTGGCATTGG 0: 1
1: 0
2: 1
3: 12
4: 134
1136127064_1136127071 29 Left 1136127064 16:28191690-28191712 CCTTGAGGAAGCACAGAGGAGTT 0: 1
1: 0
2: 2
3: 31
4: 233
Right 1136127071 16:28191742-28191764 GAGCTGGCTTTACCTGGCATTGG 0: 1
1: 0
2: 1
3: 12
4: 134
1136127063_1136127071 30 Left 1136127063 16:28191689-28191711 CCCTTGAGGAAGCACAGAGGAGT 0: 1
1: 0
2: 1
3: 14
4: 244
Right 1136127071 16:28191742-28191764 GAGCTGGCTTTACCTGGCATTGG 0: 1
1: 0
2: 1
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136127071 Original CRISPR GAGCTGGCTTTACCTGGCAT TGG Intronic
900276102 1:1829718-1829740 AAGATGGCTTGCCCTGGCATTGG - Intronic
902389226 1:16092992-16093014 GAGCGGGCTGAACCTGGAATGGG + Intergenic
906609178 1:47190275-47190297 GAGCTCCCTTTTCCTGGCAGTGG + Intronic
909327773 1:74373821-74373843 CAGCTGGCTTTGCTTGCCATGGG - Intronic
910489534 1:87753449-87753471 GAGCTGCCTTTACCACTCATGGG - Intergenic
911209030 1:95120216-95120238 GAGCTGTATTCACCTGGCATTGG + Intronic
912410194 1:109475946-109475968 GAGCTGGTGTGACCTGCCATGGG - Intronic
912945260 1:114079189-114079211 GATTTGGCTTTACCTGGCATGGG - Intergenic
914431648 1:147624531-147624553 GGACTAGCATTACCTGGCATGGG + Exonic
917188810 1:172391389-172391411 AAGCTGGATTTAACAGGCATGGG - Intronic
920543258 1:206795019-206795041 AAGGTTGCTTTAGCTGGCATGGG - Intergenic
921814577 1:219549251-219549273 AACCTGGCTTTACCTGGCTTAGG + Intergenic
924909017 1:248489017-248489039 GGTCTGTCTTTTCCTGGCATCGG + Exonic
924915088 1:248559041-248559063 GGTCTGTCTTTTCCTGGCATCGG - Exonic
1063235294 10:4108335-4108357 AAGCAAGCTTTAGCTGGCATTGG + Intergenic
1063322664 10:5066007-5066029 GTGGTGTCTTTACCTGGAATTGG + Intronic
1068767791 10:60783565-60783587 TAGCTTGCTTTCCATGGCATTGG - Intronic
1068961122 10:62867667-62867689 AAGCTGGCTTTGCATGGCCTAGG - Intronic
1069851025 10:71405085-71405107 ATGCTGGCTTTCCCTGGCTTCGG + Intronic
1070618595 10:77988762-77988784 GAGGGGGCTTTGCCTGGCAGTGG + Intronic
1070864203 10:79696332-79696354 GAGCTGGCTTGTACTGGCTTGGG - Intergenic
1071631102 10:87218558-87218580 GAGCTGGCTTGTACTGGCTTGGG - Intergenic
1072853950 10:98926786-98926808 GAGCAGACTTTTCCTGGCATGGG - Intronic
1075676861 10:124301897-124301919 GAGCTGGCTCTGACTCGCATTGG - Intergenic
1076575094 10:131460591-131460613 GTGATGGCTTTATCTGGCTTTGG + Intergenic
1076655033 10:132018352-132018374 GATCTGACTTTACCTGCCTTTGG - Intergenic
1077643557 11:3903572-3903594 GAACAGGCTGTACCAGGCATAGG + Intronic
1077885426 11:6383941-6383963 GAGCTGGCTGTACCGGGAACTGG - Intergenic
1084640105 11:70420723-70420745 GAGCTGGGTTTACCTGGAAGTGG + Intronic
1085118178 11:73948980-73949002 GAGCTGGCTTGTACTGGCTTGGG + Intergenic
1085515371 11:77108420-77108442 GAGGTGGCTTGAAGTGGCATGGG + Intronic
1087170297 11:95043158-95043180 GAGATCCCTTTACCTGGCACAGG + Intergenic
1087246216 11:95840793-95840815 GTGCTGGCTCTGCCTGGCTTTGG - Intronic
1089055758 11:115583494-115583516 AAACTGCCTTTCCCTGGCATTGG + Intergenic
1092751386 12:11722744-11722766 GATCTGGCCTCACCTGGCAATGG - Intronic
1093502318 12:19827301-19827323 GACCTGGCTTTGGCAGGCATGGG - Intergenic
1096876892 12:54636319-54636341 GTGGTGGCCTTACCTGGAATGGG + Intergenic
1099375920 12:81896392-81896414 CAGCTGGCTTTACCTCTCAAAGG - Intergenic
1103737203 12:123068138-123068160 GAGCTGGCCTGACCTGACATGGG - Intronic
1103738617 12:123076952-123076974 GAGCTGCCTGTGCCGGGCATGGG + Intronic
1105048282 12:133025441-133025463 GAGATGGCTGTACTTTGCATGGG + Exonic
1105630200 13:22156291-22156313 GAGGTGGCTCTACCTGGTACAGG - Intergenic
1106779726 13:33046114-33046136 GTGGTGGCTTTATCTGGCTTTGG + Intronic
1108988328 13:56622900-56622922 GAGGTGGCTTTAAGTGGCAGTGG - Intergenic
1109726643 13:66349679-66349701 GTGCTACCTTTACCTGGCTTAGG + Intronic
1110906423 13:80896455-80896477 CAGCTGGCTTCACCTTTCATGGG - Intergenic
1113468075 13:110525857-110525879 GAGCAGGCTGTGCATGGCATGGG + Intronic
1114878216 14:26750401-26750423 AGACTGTCTTTACCTGGCATTGG - Intergenic
1115887848 14:37993827-37993849 AATCTGCCTTTCCCTGGCATGGG - Intronic
1116275304 14:42824743-42824765 GAGGTGGGTTTACATGGTATTGG - Intergenic
1116783522 14:49263527-49263549 GGACTGGCTTTGCCTGGCATGGG - Intergenic
1117012174 14:51482178-51482200 TATCTGGCTTTACCTGACTTTGG + Intergenic
1118748015 14:68787628-68787650 GAGCTGGTTTTACTTGGTTTTGG - Intergenic
1118948962 14:70416808-70416830 GAGCCGGATTCACCTGGCCTCGG - Intronic
1119206048 14:72794298-72794320 GAGCTGGCTTTTTCTGGCACTGG - Intronic
1122325468 14:100878830-100878852 GAGCTGGTGTGTCCTGGCATGGG + Intergenic
1127742188 15:61921170-61921192 GACCTGCCTTTCTCTGGCATAGG - Intronic
1128706736 15:69842343-69842365 GACCTGGCTTTCCCTGCCACCGG - Intergenic
1129848337 15:78778178-78778200 CAGCTGGCATTCCCTGGCAGCGG + Intronic
1130253589 15:82315756-82315778 CAGCTGGCATTCCCTGGCAGCGG - Intergenic
1131749953 15:95495488-95495510 GCGCTGGCTCTGCCTGCCATAGG - Intergenic
1136127071 16:28191742-28191764 GAGCTGGCTTTACCTGGCATTGG + Intronic
1136461220 16:30411393-30411415 GAGCAGGCCCTACCTGGCCTGGG - Intronic
1138151109 16:54657965-54657987 GAGCTGGGTTAACCTGCCAAGGG - Intergenic
1140991297 16:80214468-80214490 GACCTGGATTTAGCTGGCATGGG - Intergenic
1144307669 17:13983938-13983960 GGTGAGGCTTTACCTGGCATTGG - Intergenic
1144751641 17:17652948-17652970 GAGCTGTCTTTGTCTAGCATGGG - Intergenic
1145826709 17:27882542-27882564 GAGCTGGCTCTACCAGGTCTGGG - Intronic
1148489427 17:48013572-48013594 AAGCAAGCTTTCCCTGGCATTGG - Intergenic
1151569160 17:74917501-74917523 GAGCTGGCTATGCTTGGGATGGG + Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1157580868 18:48773494-48773516 GAGCTGGGGTTGCCTGCCATGGG + Intronic
1157696038 18:49724469-49724491 CACCTGCCTGTACCTGGCATTGG - Intergenic
1159056399 18:63469130-63469152 CAGCTGGCTTTACTTGGAAAGGG - Intergenic
1162051491 19:8036562-8036584 GAGCTGGATTTCTTTGGCATGGG + Intronic
1163167324 19:15507390-15507412 CAGATGGCTTTCCCTGGCCTTGG - Intergenic
1165935342 19:39385355-39385377 GAGCTGACTGTGCCTGGCACTGG + Intronic
1168314045 19:55476405-55476427 GAGCTGGCCGTCCCTGGCCTTGG + Exonic
926286409 2:11492482-11492504 GAGCCGGCTTTGCATGGCAGAGG + Intergenic
928208543 2:29305602-29305624 AAGCTGGGTATACTTGGCATGGG - Intronic
931669091 2:64630745-64630767 GATCTGGCCTCACCTGGCCTAGG - Intergenic
936046141 2:109189261-109189283 GATCTGGAGTTACCTGGCCTTGG + Intronic
937093435 2:119221771-119221793 GAGCTTGTCTCACCTGGCATGGG - Intergenic
948632584 2:239311616-239311638 GAGCTGTCCTTTCCTGTCATGGG - Intronic
1172201984 20:33133060-33133082 GAGCTGGCTTCCCCGGGCTTAGG + Intergenic
1173859173 20:46270825-46270847 GAGCTGGGTTGACTTGGCAGTGG + Intronic
1178479502 21:32967372-32967394 AGGCTGTCTTTCCCTGGCATTGG - Intergenic
1179224256 21:39439584-39439606 CAGCTTGCTTTACCTTGCCTTGG + Intronic
1180674863 22:17580279-17580301 GAGATGGATTTACCTGGAAGTGG - Intronic
1182351564 22:29702847-29702869 AAGCTGGCTTGACATGGCCTTGG - Intergenic
1182469562 22:30539822-30539844 GGGGTGGCTTGACCTGGCCTGGG + Intronic
1183314844 22:37131280-37131302 GAGCTGTCATGACCTGGCTTTGG - Intronic
1184182901 22:42843046-42843068 GAGCTGTCCTTTCCTGGCCTTGG - Intronic
950416747 3:12873192-12873214 GGCCTGGCTTTCACTGGCATCGG + Intergenic
950635794 3:14313577-14313599 GAGTCTGGTTTACCTGGCATTGG + Intergenic
950970957 3:17187468-17187490 GGGCTGGCTTCAGCTGGCTTGGG - Intronic
951584156 3:24198081-24198103 CAGGTGGCTTTGCCTGGCCTGGG + Intronic
951841434 3:27038222-27038244 GTGATGGCTTCACCTGGAATTGG + Intergenic
952316542 3:32237843-32237865 GAGCTGTGCTTTCCTGGCATGGG - Intergenic
953788087 3:45925860-45925882 GATCTGGCTGTTCCTGGCAGTGG + Intronic
956034711 3:65078858-65078880 GAGCTGGCTATTCCTGGGAGGGG - Intergenic
961233596 3:125343331-125343353 CAGCTGGCTTCACCTCTCATTGG - Intronic
961722967 3:128908343-128908365 GAGCTGCCTTGACCTGGAGTGGG + Intronic
962990421 3:140572777-140572799 GAGATGACTTGAGCTGGCATCGG + Exonic
967165581 3:186776639-186776661 CAGTTGGCTTTTGCTGGCATGGG + Intergenic
970622938 4:17844821-17844843 AAGCTTGCTTTCTCTGGCATGGG + Exonic
971173743 4:24261232-24261254 GAGATAGATTTGCCTGGCATTGG - Intergenic
972793674 4:42396842-42396864 GAGCTGGCCTTGGCTGGCAGAGG + Intergenic
973649216 4:52980986-52981008 GAACTGGATTGAACTGGCATGGG + Intronic
974889364 4:67861197-67861219 AAACTGGCTTTCCCTGACATGGG + Intronic
976751208 4:88452763-88452785 GTGGTGCCTTTACCTGGCACTGG - Intergenic
981615314 4:146638767-146638789 GAGCCGGCGTTTCCTGGCAAGGG + Intergenic
981812048 4:148786777-148786799 GAGCTAGCTTTACATGTCTTAGG + Intergenic
983606232 4:169588706-169588728 GAGCTGGCTCGAACTTGCATAGG - Exonic
985097404 4:186427018-186427040 GAGCTGGCTTGTCCTGGCTTTGG + Exonic
986213158 5:5693181-5693203 GAGCTGGCTTCGCCTGCCTTGGG - Intergenic
988591383 5:32552938-32552960 CAGCTGGCTTCACCTGTCACTGG + Intronic
994362702 5:98872170-98872192 GAGCTGCCTTTGTGTGGCATGGG + Exonic
996760643 5:126983122-126983144 GAGCTGGCTTAACCATGCAGAGG + Intronic
998131588 5:139654027-139654049 GGGCTGGTGTTACCTGGTATGGG + Intronic
1000029357 5:157389084-157389106 GAGCTGGCTGCACCTGAAATTGG - Intronic
1001657599 5:173364132-173364154 GAGCTGCCCTTAACTGGCATCGG - Intergenic
1011543173 6:88455479-88455501 CTCCTGGCTTTAGCTGGCATTGG + Intergenic
1020278601 7:6638466-6638488 GAGTTGGGTTTCCCTGGCTTTGG + Intronic
1022357646 7:29630925-29630947 CAGCTGGCTTTTCCTGGGTTTGG - Intergenic
1022367963 7:29743885-29743907 CAGCTGGCTTTTCCTGGGTTTGG - Intergenic
1022450327 7:30507840-30507862 CAGCTGGCTTCACCTGTCACTGG + Intronic
1031117945 7:117688452-117688474 GAGCACACATTACCTGGCATGGG + Intronic
1031730890 7:125299430-125299452 GAGCTGGCTTCACCTCTCACTGG + Intergenic
1033964462 7:146958175-146958197 CAGCTGCCTTTACGTGACATAGG + Intronic
1034154518 7:148945453-148945475 CAGCTGGCTTTCCCCGGCAAAGG - Intergenic
1034245525 7:149641446-149641468 GGGCTGTCTTTAGCTGGCAGAGG + Intergenic
1046019724 8:108650185-108650207 GAGTTGCCATTACCTGGCATGGG - Intronic
1051783114 9:20712246-20712268 GAGCTGCCATCACCTGACATGGG - Intronic
1055730454 9:79275104-79275126 AAGCTGCCTTTACCGGGGATTGG - Intergenic
1056259180 9:84830655-84830677 AAACTGCCTCTACCTGGCATAGG - Intronic
1059856124 9:118399282-118399304 GAGCAGGATCTACCTGGCAGAGG - Intergenic
1060601312 9:124880086-124880108 GAGTTGGCTGTTCCTGGCAGAGG + Exonic
1061484088 9:130911678-130911700 GGGCTGGGTTTCCCTGGCCTCGG - Intronic
1062098207 9:134713462-134713484 AAGGTGGCTTTACCTGTGATGGG - Intronic
1062263754 9:135677135-135677157 GAGCTGGCATGGGCTGGCATGGG + Intergenic
1185768206 X:2743556-2743578 CAGCTGGCTTTTTCTGGCATTGG - Intergenic
1188862289 X:35271822-35271844 GAGCTGGCCTGGCTTGGCATGGG + Intergenic
1190335478 X:49259212-49259234 GAGCTGACATTACCTGAGATGGG + Intronic
1191150965 X:57220756-57220778 CTGCTGGCTTTACCTGGGTTTGG - Intergenic
1196327708 X:114427383-114427405 AAGCTGTCTTTTCCTGGCTTTGG + Intergenic
1196585025 X:117419308-117419330 GACCTGGCTTGGCCTGGCAAGGG - Intergenic
1200430371 Y:3072816-3072838 CAGCTGGCTTCACCTGTCACTGG - Intergenic