ID: 1136129155

View in Genome Browser
Species Human (GRCh38)
Location 16:28208522-28208544
Sequence AATCCTATTCACATCAACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136129153_1136129155 4 Left 1136129153 16:28208495-28208517 CCACTGTGTCAGTGACACAAAAA 0: 1
1: 0
2: 2
3: 22
4: 250
Right 1136129155 16:28208522-28208544 AATCCTATTCACATCAACTATGG 0: 1
1: 0
2: 2
3: 7
4: 115
1136129150_1136129155 26 Left 1136129150 16:28208473-28208495 CCCTGGGATACCTACAGATGAAC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1136129155 16:28208522-28208544 AATCCTATTCACATCAACTATGG 0: 1
1: 0
2: 2
3: 7
4: 115
1136129152_1136129155 16 Left 1136129152 16:28208483-28208505 CCTACAGATGAACCACTGTGTCA 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1136129155 16:28208522-28208544 AATCCTATTCACATCAACTATGG 0: 1
1: 0
2: 2
3: 7
4: 115
1136129151_1136129155 25 Left 1136129151 16:28208474-28208496 CCTGGGATACCTACAGATGAACC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1136129155 16:28208522-28208544 AATCCTATTCACATCAACTATGG 0: 1
1: 0
2: 2
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136129155 Original CRISPR AATCCTATTCACATCAACTA TGG Intronic
910820558 1:91340391-91340413 AATCCTTTTCAGATAAGCTAAGG + Intronic
913111041 1:115657335-115657357 ACTTCTATTCACACCTACTATGG - Intronic
918267969 1:182864547-182864569 ATTTCTAGTCAAATCAACTAGGG + Intronic
918807928 1:189073935-189073957 AATCCAATTTTCATCATCTATGG + Intergenic
919040692 1:192384080-192384102 AATCCTAATCAGAACAATTAGGG + Intergenic
919286975 1:195576443-195576465 AATCATATTCATATCAAATATGG + Intergenic
920816337 1:209336650-209336672 AATACTATTCACAACAGCAAAGG + Intergenic
923811536 1:237323378-237323400 AATTGTATGCACATCAACAATGG + Intronic
1064499112 10:15949524-15949546 GGTCCTATTCACAAAAACTACGG - Intergenic
1068395767 10:56459381-56459403 ACTCCAATTCACAACAACTCAGG + Intergenic
1076416932 10:130297979-130298001 AGTCCTCTACACATCAAATAAGG + Intergenic
1080695946 11:34603101-34603123 AAACCAATCCACATTAACTATGG + Intergenic
1081828757 11:46086781-46086803 AATTCAATTCACATAAACTCTGG + Intronic
1087512297 11:99112906-99112928 AATCCTATTCAAATTAAAAAGGG - Intronic
1088475520 11:110234549-110234571 AATTGTATTCCCATAAACTAGGG - Intronic
1093147026 12:15578799-15578821 AATCCAATTCACACCACGTATGG + Intronic
1094430617 12:30365909-30365931 AATCCTATTTATATGAACAAAGG + Intergenic
1095154539 12:38836002-38836024 AATCCTGTACACACCAATTATGG + Intronic
1095729429 12:45490662-45490684 AATTCTATTCATAGCCACTAGGG + Intergenic
1096792134 12:54051901-54051923 AATCCTTTTCTCATCACCTTTGG - Intronic
1099561694 12:84185145-84185167 AAACCTATTTAAATAAACTAAGG + Intergenic
1099848481 12:88060120-88060142 AATTCTAATCATATCAAATATGG - Intronic
1100163499 12:91889813-91889835 AATCCTACTCACATCATGAAAGG + Intergenic
1101774860 12:107784372-107784394 ATTCATATTCACAGCAACTGAGG + Intergenic
1102901023 12:116637002-116637024 AAGACTATTCCCATCATCTAGGG - Intergenic
1107654964 13:42582871-42582893 CAACCTATTCACATGCACTAGGG + Intronic
1112447908 13:99482522-99482544 AATCCTATTAAAATGAACTTTGG - Intergenic
1117790318 14:59333320-59333342 AATGCTATACACACCAAATAAGG + Intronic
1120297774 14:82665506-82665528 AACCCTATTAACATCAAAAAAGG - Intergenic
1121500218 14:94429713-94429735 ATTACAATTCAAATCAACTATGG + Intergenic
1124194633 15:27610963-27610985 AATCTTTTTCACAACATCTATGG - Intergenic
1130622270 15:85476084-85476106 AATCCTATTAAAATCAGCAAGGG + Intronic
1131611034 15:93964030-93964052 AATGCTATTTTCATCAACTATGG - Intergenic
1135811364 16:25589645-25589667 AATCCTATCGCCATCATCTAAGG + Intergenic
1136129155 16:28208522-28208544 AATCCTATTCACATCAACTATGG + Intronic
1140227694 16:73091640-73091662 AATGCAATTCACCACAACTAAGG - Intergenic
1140610712 16:76595720-76595742 AATCCAATTCAAATTATCTAGGG + Intronic
1148012511 17:44494661-44494683 GCTCCTATTCACATTAACTCTGG + Intronic
1155782952 18:29861878-29861900 AATCTTTTTCACATGAATTATGG - Intergenic
1156246894 18:35309352-35309374 AATCCCATTAACATAAACTCAGG - Intergenic
1161161733 19:2765482-2765504 AATCATATCTACATCCACTAAGG + Intronic
1162407761 19:10485898-10485920 ATTCCTAGTCACATCTCCTAGGG - Intergenic
924975967 2:175633-175655 AATCCTATTCACATGCTATAAGG + Intergenic
925655828 2:6147921-6147943 AATACCATACACATCAAATAAGG + Intergenic
929019644 2:37538867-37538889 AATCCCATTCACATAACCCAAGG - Intergenic
931036341 2:58247495-58247517 AATCCTATCCCAATCAACAAAGG - Intergenic
933452301 2:82470493-82470515 AATGCAATTAACATCATCTAAGG - Intergenic
939328968 2:140733894-140733916 ATTCCTAATCAAATCACCTATGG + Intronic
939762908 2:146206610-146206632 ACTCACATTCTCATCAACTAAGG + Intergenic
940703520 2:157075700-157075722 AATCTTATTCACCTCTACAAAGG + Intergenic
941348116 2:164395571-164395593 AATTCCAATCACATCAACTAGGG - Intergenic
941663885 2:168224104-168224126 AATCATATTCACATAAACTTTGG + Intronic
943691935 2:190878371-190878393 AATGCTCTCCACATTAACTATGG - Intergenic
944528307 2:200642577-200642599 GATCTTAATCACATCAACTCTGG + Intronic
1175649517 20:60707029-60707051 AGCACTGTTCACATCAACTACGG + Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176945751 21:14979374-14979396 AATCCTACTAAACTCAACTATGG + Intronic
1178193051 21:30308228-30308250 AATCCAATTCACCTCAGGTAGGG - Intergenic
949100322 3:136438-136460 AAACCTATTCCCAACATCTATGG - Intergenic
949643757 3:6069375-6069397 ATTCATTTTCACATCACCTATGG - Intergenic
951079304 3:18432352-18432374 AATAACATTCATATCAACTAAGG - Intronic
951593116 3:24288004-24288026 AATCCTATTCAGTGCAACTTTGG - Intronic
952004518 3:28827154-28827176 AATTCACTTCACATCAACTAGGG - Intergenic
952135029 3:30409255-30409277 AGTCCTTTTCACATCATCTCAGG - Intergenic
954355769 3:50083118-50083140 AACCCTATTAACGTCAACAAGGG - Intronic
957743861 3:84312306-84312328 AAACCTACTCACATTAACTTAGG + Intergenic
957838485 3:85633065-85633087 AAGTCTATTGACAACAACTATGG + Intronic
964587331 3:158320914-158320936 AATCCCATTCATTTGAACTATGG - Intronic
966003099 3:174974485-174974507 AATACTTTTCATGTCAACTAAGG + Intronic
966794490 3:183700393-183700415 TGTCCTCTTCTCATCAACTACGG + Intronic
972728261 4:41765746-41765768 AACCATATTCAGATCATCTAGGG + Intergenic
979673739 4:123388205-123388227 ATCCCTATTCCCATCAACTGAGG + Intergenic
979904417 4:126268080-126268102 TATAATATTTACATCAACTATGG - Intergenic
980029442 4:127809890-127809912 AATCCTATAAACAGCAAATATGG - Intronic
982193199 4:152879209-152879231 TTTTCTATTCTCATCAACTAAGG - Intronic
984045710 4:174796078-174796100 ACTCCTATTACCATCAACTTAGG - Intronic
985103587 4:186481342-186481364 ATTCATATTCAGATCAACTCTGG + Intronic
985156716 4:186996830-186996852 TATCTTATTCAGACCAACTATGG + Intergenic
985318887 4:188687162-188687184 AATTTTATTCACATAAACGAAGG + Intergenic
987827336 5:23049890-23049912 AATCCAATTGATATCAAATATGG + Intergenic
988996572 5:36721091-36721113 AATCCTATTCACATAAATCCAGG + Intergenic
990809682 5:59708854-59708876 AATGCTATTGACATAAACTCAGG - Intronic
992012262 5:72540745-72540767 AGACCTATTCACATCATATAAGG + Intergenic
992480741 5:77150253-77150275 AATCCTGTTCCCATCGACTGAGG - Intergenic
994390832 5:99191528-99191550 ATTCTTATACACATCAACTGGGG + Intergenic
994702754 5:103157728-103157750 TATCTTCTTCACTTCAACTAAGG + Intronic
994939923 5:106309972-106309994 AATGCTATTGTCATCAACCATGG + Intergenic
998687661 5:144547953-144547975 AATCATAGTCAAATTAACTATGG - Intergenic
1006349857 6:33513088-33513110 AATCCTATGCAAAACAGCTAGGG + Intergenic
1006868874 6:37232203-37232225 AATTCTATTTGCATCAACTTGGG - Intronic
1008489632 6:52072666-52072688 GATCATATTCTCTTCAACTAGGG + Intronic
1010405442 6:75500450-75500472 AATCGTATTCCCATCTCCTAAGG - Intergenic
1010673324 6:78712633-78712655 GATTCCATTCACATTAACTAGGG - Intergenic
1016521654 6:144953268-144953290 AATGCTATAAACATCAGCTATGG - Intergenic
1017353122 6:153468088-153468110 TATCATATTCACATCAGCAAAGG - Intergenic
1020916589 7:14201293-14201315 ACTCCTAGTAACATCACCTAGGG + Intronic
1021590604 7:22256877-22256899 AATGCTATTCACATCCACTAAGG + Intronic
1024061396 7:45701486-45701508 AATACTATTAACATTAACAATGG + Intronic
1024736379 7:52309356-52309378 AATTCTATTCATAACAAGTATGG - Intergenic
1026636058 7:72082746-72082768 ACTCCTATCCAACTCAACTACGG + Intronic
1027882841 7:83863962-83863984 AATGCTAATCAAATCAACTCAGG - Intergenic
1041184337 8:55283475-55283497 AATCACTTTCACATAAACTAAGG - Intronic
1041329049 8:56703495-56703517 ATTCCAATTCACATCTAATATGG - Intergenic
1041452872 8:58025854-58025876 AAAAATATTTACATCAACTAGGG - Intronic
1041631363 8:60091716-60091738 GTTCTCATTCACATCAACTAGGG + Intergenic
1043924106 8:86017340-86017362 ATTCCTCTTCTCATCAAGTAAGG - Intronic
1044414624 8:91923100-91923122 ACTCTTAATCACATCACCTAGGG - Intergenic
1045625254 8:104038927-104038949 GATCATATTCAGATAAACTATGG + Intronic
1051988172 9:23117045-23117067 AATCCTATTAACAACAAGTAAGG - Intergenic
1052236485 9:26217263-26217285 CATACTATTCACATTCACTATGG + Intergenic
1056248868 9:84727848-84727870 AATCCCACTCACATGAACAATGG + Exonic
1059227632 9:112687096-112687118 AATCCTATAAACAGCAAATATGG + Exonic
1060144457 9:121239579-121239601 AATACTGTTCATACCAACTATGG + Intronic
1185931641 X:4210201-4210223 AATCCTATTCACAATAGCAAAGG + Intergenic
1186363423 X:8866986-8867008 AAGTCTATTAACATCATCTATGG + Intergenic
1187771924 X:22708362-22708384 AATCCTATTCACATGTACTAAGG - Intergenic
1188464886 X:30468456-30468478 AATCCTATTCACATTCACGAGGG + Intergenic
1190463642 X:50704376-50704398 AATAGTTTTCACATCAACAATGG - Intronic
1191686361 X:63895769-63895791 AATTCTATTCTCTTCAACTTTGG - Intergenic
1196677077 X:118430996-118431018 AAACATCTTCACATCAACCATGG - Intronic
1200677301 Y:6164695-6164717 AATTCTATTAACAACGACTAGGG + Intergenic