ID: 1136129954

View in Genome Browser
Species Human (GRCh38)
Location 16:28213391-28213413
Sequence TTGAATAGGAATGATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136129949_1136129954 24 Left 1136129949 16:28213344-28213366 CCTGGCTTCAAGTGGGTTTCTAA No data
Right 1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG No data
1136129948_1136129954 27 Left 1136129948 16:28213341-28213363 CCGCCTGGCTTCAAGTGGGTTTC No data
Right 1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG No data
1136129947_1136129954 28 Left 1136129947 16:28213340-28213362 CCCGCCTGGCTTCAAGTGGGTTT No data
Right 1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136129954 Original CRISPR TTGAATAGGAATGATGAGAA AGG Intergenic
No off target data available for this crispr