ID: 1136130562

View in Genome Browser
Species Human (GRCh38)
Location 16:28218083-28218105
Sequence TTGCACTCCACCCTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136130556_1136130562 16 Left 1136130556 16:28218044-28218066 CCTGGGAGGTGGAGGTTGCAGTG 0: 31005
1: 97113
2: 188789
3: 192956
4: 135326
Right 1136130562 16:28218083-28218105 TTGCACTCCACCCTGGGGACAGG No data
1136130557_1136130562 -9 Left 1136130557 16:28218069-28218091 CCAAGATCACGCCATTGCACTCC 0: 5093
1: 35904
2: 102518
3: 136907
4: 125793
Right 1136130562 16:28218083-28218105 TTGCACTCCACCCTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136130562 Original CRISPR TTGCACTCCACCCTGGGGAC AGG Intergenic
No off target data available for this crispr