ID: 1136145147

View in Genome Browser
Species Human (GRCh38)
Location 16:28312135-28312157
Sequence CACGCCCAACAGGGAGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136145147_1136145156 1 Left 1136145147 16:28312135-28312157 CCAGCGTCTCCCTGTTGGGCGTG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1136145156 16:28312159-28312181 GGAGGAGTTTGCGGCAAAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 177
1136145147_1136145155 0 Left 1136145147 16:28312135-28312157 CCAGCGTCTCCCTGTTGGGCGTG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1136145155 16:28312158-28312180 GGGAGGAGTTTGCGGCAAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 276
1136145147_1136145160 28 Left 1136145147 16:28312135-28312157 CCAGCGTCTCCCTGTTGGGCGTG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1136145160 16:28312186-28312208 GTGCTCATCAGAGCCCCTGGGGG 0: 1
1: 0
2: 0
3: 25
4: 221
1136145147_1136145154 -8 Left 1136145147 16:28312135-28312157 CCAGCGTCTCCCTGTTGGGCGTG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1136145154 16:28312150-28312172 TGGGCGTGGGGAGGAGTTTGCGG 0: 1
1: 0
2: 4
3: 66
4: 578
1136145147_1136145157 25 Left 1136145147 16:28312135-28312157 CCAGCGTCTCCCTGTTGGGCGTG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1136145157 16:28312183-28312205 TGCGTGCTCATCAGAGCCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 154
1136145147_1136145159 27 Left 1136145147 16:28312135-28312157 CCAGCGTCTCCCTGTTGGGCGTG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1136145159 16:28312185-28312207 CGTGCTCATCAGAGCCCCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 143
1136145147_1136145158 26 Left 1136145147 16:28312135-28312157 CCAGCGTCTCCCTGTTGGGCGTG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1136145158 16:28312184-28312206 GCGTGCTCATCAGAGCCCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136145147 Original CRISPR CACGCCCAACAGGGAGACGC TGG (reversed) Intronic
902885912 1:19404686-19404708 CTGGCCAAACAGGGAAACGCAGG + Intronic
903886700 1:26545071-26545093 CGCACCCAACAGGCAGAGGCAGG - Intronic
903886768 1:26545496-26545518 GACACCCAACAGGCAGAAGCAGG - Intronic
904364777 1:30003270-30003292 CACTCCCAACAGAGAGATGCAGG + Intergenic
906192644 1:43907896-43907918 GACGGCAAACAGGGAGACACTGG - Intronic
907290559 1:53409843-53409865 TTTGCCGAACAGGGAGACGCAGG + Intergenic
907919176 1:58896853-58896875 CTCGCCCTACAGGGAAACACTGG - Intergenic
914276205 1:146126389-146126411 CACGCTCAGCAGGGAGCTGCTGG - Exonic
917724952 1:177819459-177819481 CAAGCCCAACAGGGAAGGGCTGG + Intergenic
918132642 1:181643252-181643274 GAAGCCCAACAGGGAGATGCCGG - Intronic
918478468 1:184951662-184951684 CAAGCCAAACAGGAAGAAGCTGG - Intronic
1062932589 10:1362948-1362970 CACTCCCAACAGGGAAAGGTCGG + Intronic
1067731239 10:48812912-48812934 CACTCCCACCAGGCAGACGATGG - Intronic
1069007975 10:63339142-63339164 CCAGCCCAACAGGGAGAAGATGG + Intronic
1069857868 10:71451620-71451642 AACCCCCAACAAGGAGACCCAGG - Intronic
1071544979 10:86522031-86522053 CCGGCCCAGCCGGGAGACGCAGG + Intergenic
1075514004 10:123094937-123094959 CAAGCCCATCAGGGAGGGGCTGG + Intergenic
1076802148 10:132835751-132835773 AAGGCCCACCAGGGAGCCGCTGG - Intronic
1077337960 11:2013869-2013891 CAATCCCATCAGGGAGACTCTGG - Intergenic
1077499634 11:2903317-2903339 CAGGCGCAGCAGGGAGACCCAGG - Exonic
1078097622 11:8310373-8310395 CAGACCCAACAGGGAGGGGCTGG - Intergenic
1078756960 11:14220172-14220194 CATGCCCAACAGTGAGAAACAGG - Intronic
1089156764 11:116408757-116408779 CCCGCCCAACAGGGAGATCTAGG + Intergenic
1089346455 11:117794862-117794884 GGCGCCCAACAGACAGACGCTGG + Intronic
1091369074 11:135043839-135043861 CAGGCCCTGCAGGGAGACTCAGG - Intergenic
1202820944 11_KI270721v1_random:69051-69073 CAATCCCATCAGGGAGACTCTGG - Intergenic
1095977375 12:47949050-47949072 CAGGCCTGACAGGGAGAGGCGGG - Intergenic
1096717455 12:53499807-53499829 CACCGCCAGCAGGGAGGCGCGGG - Intronic
1104384089 12:128334397-128334419 CAGGCTCAATAGGGAGACACTGG - Intronic
1104388717 12:128373834-128373856 CACGAGCATCAGGGAGATGCAGG + Intronic
1113513206 13:110872157-110872179 CACCCCCCGCAGGGAGAGGCGGG - Intergenic
1114385277 14:22247618-22247640 CACACCCAGCAGGAAGACTCTGG - Intergenic
1114683330 14:24505649-24505671 CTCCCCCTACAGGGAGACTCTGG - Exonic
1119724571 14:76914185-76914207 CACGGCCACCAGGGAGACTTTGG + Intergenic
1122922548 14:104885984-104886006 CAAGCCCAACGGCGAGAAGCAGG - Intronic
1128712340 15:69881536-69881558 CACGGGCAACAGGGAGGCTCCGG + Intergenic
1129794216 15:78363702-78363724 CAGGCCCAACAGTGGGACTCCGG + Intergenic
1132387112 15:101408466-101408488 CATGGCCACCAGGGAGACACAGG + Intronic
1136145147 16:28312135-28312157 CACGCCCAACAGGGAGACGCTGG - Intronic
1139508404 16:67411345-67411367 CACTGCCAATGGGGAGACGCAGG + Intronic
1140726916 16:77822002-77822024 CATGCCCATAAGGGAGACACAGG + Intronic
1142807022 17:2376578-2376600 CACCCCCCACAGGGAGACAACGG - Intronic
1145915961 17:28574157-28574179 CAAGCCCAACATGGTGACCCCGG - Exonic
1151370695 17:73644745-73644767 CGCGCCGAATCGGGAGACGCCGG + Intergenic
1151543654 17:74778549-74778571 CAGGCCCAATAGGAAGACTCTGG - Intronic
1151951208 17:77355205-77355227 CACACCCCAAAGGGAGATGCTGG - Intronic
1152566213 17:81101514-81101536 CAAGCCCACCAGGGAGGCCCTGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154371771 18:13769792-13769814 CACACTGAACAGGGAGAAGCTGG + Intergenic
1161128540 19:2574148-2574170 CAGGCCCAGCAGGGACACCCCGG - Intronic
1166117283 19:40663608-40663630 CACGCCCAGGATGGAGACTCTGG - Intergenic
1167113693 19:47476544-47476566 CACGCCCTTCAGGGAGACCACGG + Exonic
1167293051 19:48635078-48635100 CACGCCCCACTGGGGGACCCAGG + Intronic
1167497585 19:49828629-49828651 CATGCCCTACAGGGTGAGGCTGG - Intronic
929795416 2:45055189-45055211 CTCGCCCAACTGTGAGAAGCGGG - Intergenic
932343072 2:70978864-70978886 CCTGCCCACCAGGGAGGCGCTGG - Intronic
932675834 2:73780094-73780116 CATGCGCAATAGCGAGACGCTGG - Exonic
932960028 2:76402831-76402853 CACACCCAACAAGGAGATGCTGG + Intergenic
943650893 2:190456562-190456584 TAAGCCCAAGAGGGAGACTCTGG + Intronic
944465376 2:199995057-199995079 CACACCCAACTGGAAGAGGCTGG - Intronic
946523423 2:220491739-220491761 CCTTCCCAACAGGGAGAGGCAGG - Intergenic
947971947 2:234332125-234332147 CAGTCCGAACAGAGAGACGCAGG - Intergenic
1170477522 20:16730397-16730419 CACCACCAAAAGGGAGCCGCTGG - Intronic
1172096722 20:32464046-32464068 CACACACAACAGGGCGACGGGGG + Intronic
1174197923 20:48786370-48786392 CATGACCAACAAGGAGACTCAGG + Intronic
1176864800 21:14041248-14041270 CACGCCCATCAGGGACAGACTGG - Intergenic
1177329364 21:19636403-19636425 CACGCACATCAGGGAGAACCAGG - Intergenic
1180196333 21:46196718-46196740 CACGTCCCACAGGGTGACACTGG - Intronic
1181742778 22:24934558-24934580 CACTCCCACCTGGGAGACACAGG - Intergenic
1182208867 22:28656445-28656467 CACTCGCAACAGGGAGCAGCTGG + Intronic
1183211494 22:36454173-36454195 CACGCCCAACAGTGACAGGTTGG - Intergenic
1184354405 22:43969402-43969424 CAGGCCCCAGAGGGAGACACAGG + Intronic
1184649109 22:45911589-45911611 CACCCCCAACAGGAGGACGCCGG + Intergenic
950657000 3:14442784-14442806 CAAACCCAACAGGGAGCCGGAGG + Intronic
956011074 3:64832298-64832320 CAAGGCCAAGGGGGAGACGCTGG - Intergenic
961206985 3:125092098-125092120 CACCCCCAACAGGGAGACCCAGG + Exonic
964129311 3:153269028-153269050 GACGCCCATCGGGGAGACTCCGG - Intergenic
966097762 3:176227136-176227158 CAGGACCAACAGAGAGACGGGGG - Intergenic
966851597 3:184168241-184168263 CAGGCCCAAGAGGGAGATGTGGG - Intronic
969264230 4:6054696-6054718 CAGACCCAGCTGGGAGACGCTGG + Intronic
969301830 4:6301519-6301541 CACGCCCACCAGGGCCAGGCCGG - Exonic
975689331 4:76949312-76949334 CACGCCCCACCCGGAGAAGCCGG - Intergenic
981078856 4:140618308-140618330 CACCCCCACCAAGGTGACGCAGG - Intergenic
985628950 5:1005013-1005035 GACGCCCAGCGGGGAGACCCGGG - Intergenic
998510910 5:142713307-142713329 CACCCCGGACACGGAGACGCGGG + Intergenic
999327097 5:150650214-150650236 CACGCCCTGGAGGGAGACACGGG - Exonic
1006396093 6:33788657-33788679 GACGCCCGACAGGGCCACGCAGG - Exonic
1011083901 6:83517629-83517651 GACACACAACAGGGAGACACTGG - Intronic
1012351769 6:98260222-98260244 CATGCCCAACAGGTAGAAGATGG - Intergenic
1018731814 6:166657066-166657088 CACCCCCAACACAGAGACGGTGG + Intronic
1022466674 7:30656724-30656746 CACACCCAGCAGGGAGCAGCTGG - Intronic
1025281297 7:57627830-57627852 CAGGCCCAAGATGGACACGCAGG - Intergenic
1025303432 7:57837677-57837699 CAGGCCCAAGATGGACACGCAGG + Intergenic
1034889571 7:154827919-154827941 CATCCCCAACAGGGAGAAACTGG - Intronic
1035231057 7:157465933-157465955 CACTCTCTACAGGTAGACGCTGG - Intergenic
1045459278 8:102412376-102412398 CACGCCCGGCAGGGAGGCGGCGG - Exonic
1046717989 8:117587927-117587949 CACACACACCAGGGAAACGCTGG + Intergenic
1048193071 8:132308063-132308085 CAGGCCCAGCAGGGAGCTGCAGG + Intronic
1049294081 8:141820812-141820834 CTCGCCCACCAGGGAGCCCCTGG - Intergenic
1054710864 9:68509590-68509612 CACGCCACACAGGGCCACGCAGG + Intronic
1057761234 9:97876233-97876255 CACGCCCACCAGGGATGCACAGG + Intergenic
1057824316 9:98360446-98360468 CACACCCTGCAGGGAGACACAGG + Intronic
1060940798 9:127541913-127541935 CAAGCCCAACAGGGTGAGGCAGG + Intronic
1061487230 9:130926089-130926111 CACGCCCCACAGAGGGACACAGG + Intronic
1061814795 9:133188249-133188271 CAAGCCCCAGAGGGGGACGCTGG - Intergenic
1195610707 X:106863575-106863597 CCCGCCCAACTGGGAGCTGCGGG + Intronic
1199698613 X:150361267-150361289 CCAGCCCAACAGGGCGAGGCTGG - Intergenic