ID: 1136146706

View in Genome Browser
Species Human (GRCh38)
Location 16:28320615-28320637
Sequence TGCGCGCGCGGTGCGAGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136146706_1136146726 25 Left 1136146706 16:28320615-28320637 CCGGCCCTCGCACCGCGCGCGCA 0: 1
1: 0
2: 2
3: 6
4: 145
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146706_1136146718 8 Left 1136146706 16:28320615-28320637 CCGGCCCTCGCACCGCGCGCGCA 0: 1
1: 0
2: 2
3: 6
4: 145
Right 1136146718 16:28320646-28320668 GGGGACCGCCCGCCCGCCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 165
1136146706_1136146719 9 Left 1136146706 16:28320615-28320637 CCGGCCCTCGCACCGCGCGCGCA 0: 1
1: 0
2: 2
3: 6
4: 145
Right 1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136146706 Original CRISPR TGCGCGCGCGGTGCGAGGGC CGG (reversed) Exonic