ID: 1136146719

View in Genome Browser
Species Human (GRCh38)
Location 16:28320647-28320669
Sequence GGGACCGCCCGCCCGCCGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136146704_1136146719 22 Left 1136146704 16:28320602-28320624 CCGAGCTGCGCCGCCGGCCCTCG 0: 1
1: 0
2: 3
3: 13
4: 146
Right 1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 222
1136146707_1136146719 5 Left 1136146707 16:28320619-28320641 CCCTCGCACCGCGCGCGCAAGCC 0: 1
1: 0
2: 1
3: 2
4: 26
Right 1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 222
1136146705_1136146719 12 Left 1136146705 16:28320612-28320634 CCGCCGGCCCTCGCACCGCGCGC 0: 1
1: 0
2: 2
3: 31
4: 259
Right 1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 222
1136146711_1136146719 -3 Left 1136146711 16:28320627-28320649 CCGCGCGCGCAAGCCCCCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 222
1136146708_1136146719 4 Left 1136146708 16:28320620-28320642 CCTCGCACCGCGCGCGCAAGCCC 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 222
1136146706_1136146719 9 Left 1136146706 16:28320615-28320637 CCGGCCCTCGCACCGCGCGCGCA 0: 1
1: 0
2: 2
3: 6
4: 145
Right 1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136146719 Original CRISPR GGGACCGCCCGCCCGCCGCC GGG Exonic