ID: 1136146726

View in Genome Browser
Species Human (GRCh38)
Location 16:28320663-28320685
Sequence CGCCGGGCCACTGCGCCTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136146716_1136146726 -3 Left 1136146716 16:28320643-28320665 CCCGGGGACCGCCCGCCCGCCGC 0: 1
1: 1
2: 2
3: 37
4: 313
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146717_1136146726 -4 Left 1136146717 16:28320644-28320666 CCGGGGACCGCCCGCCCGCCGCC 0: 1
1: 0
2: 4
3: 70
4: 574
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146708_1136146726 20 Left 1136146708 16:28320620-28320642 CCTCGCACCGCGCGCGCAAGCCC 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146713_1136146726 0 Left 1136146713 16:28320640-28320662 CCCCCCGGGGACCGCCCGCCCGC 0: 1
1: 0
2: 4
3: 40
4: 314
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146706_1136146726 25 Left 1136146706 16:28320615-28320637 CCGGCCCTCGCACCGCGCGCGCA 0: 1
1: 0
2: 2
3: 6
4: 145
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146711_1136146726 13 Left 1136146711 16:28320627-28320649 CCGCGCGCGCAAGCCCCCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146705_1136146726 28 Left 1136146705 16:28320612-28320634 CCGCCGGCCCTCGCACCGCGCGC 0: 1
1: 0
2: 2
3: 31
4: 259
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146714_1136146726 -1 Left 1136146714 16:28320641-28320663 CCCCCGGGGACCGCCCGCCCGCC 0: 1
1: 0
2: 2
3: 47
4: 380
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146707_1136146726 21 Left 1136146707 16:28320619-28320641 CCCTCGCACCGCGCGCGCAAGCC 0: 1
1: 0
2: 1
3: 2
4: 26
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136146715_1136146726 -2 Left 1136146715 16:28320642-28320664 CCCCGGGGACCGCCCGCCCGCCG 0: 1
1: 0
2: 1
3: 34
4: 300
Right 1136146726 16:28320663-28320685 CGCCGGGCCACTGCGCCTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136146726 Original CRISPR CGCCGGGCCACTGCGCCTCG AGG Exonic