ID: 1136146964

View in Genome Browser
Species Human (GRCh38)
Location 16:28321502-28321524
Sequence CCTCCCTTCTGGAGGCTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 12, 3: 84, 4: 626}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136146952_1136146964 29 Left 1136146952 16:28321450-28321472 CCTGGGCACAGGCTGGGATCAGG 0: 1
1: 0
2: 3
3: 45
4: 417
Right 1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG 0: 1
1: 0
2: 12
3: 84
4: 626
1136146951_1136146964 30 Left 1136146951 16:28321449-28321471 CCCTGGGCACAGGCTGGGATCAG 0: 1
1: 0
2: 2
3: 28
4: 342
Right 1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG 0: 1
1: 0
2: 12
3: 84
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136146964 Original CRISPR CCTCCCTTCTGGAGGCTGGA GGG Exonic
900346766 1:2213927-2213949 CCTCCGTGCCGGAGGCTGGTGGG + Intergenic
900712259 1:4121910-4121932 CCTCCCTTCTGAGGGTTGCACGG + Intergenic
900979971 1:6040722-6040744 CCTCCCCTCTGGAGGTGGAAGGG + Intronic
902238957 1:15075631-15075653 CCTCCCTTCTGGAGGCCCATAGG - Intronic
902537761 1:17131103-17131125 CTACCATTCTGGAGTCTGGAGGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903373209 1:22850182-22850204 CCTCCCTTCTGGAGGGGGAGGGG + Intronic
904311799 1:29633959-29633981 CCTCCTTCCCTGAGGCTGGAGGG + Intergenic
904597756 1:31657449-31657471 CCTCTCTTCTGGTGGCTGCTGGG + Intronic
905244117 1:36600858-36600880 CCTCCATCCTGGAGGCAGAATGG + Intergenic
905858750 1:41332129-41332151 TCACAATTCTGGAGGCTGGAAGG + Intergenic
906017101 1:42591720-42591742 CTACCATTCTGGAGTCTGGAGGG - Intronic
906301710 1:44687121-44687143 TCACAGTTCTGGAGGCTGGAAGG + Intronic
906356580 1:45111580-45111602 CATTCCTTCTGGAGGCTCTAGGG + Intronic
906915438 1:50004508-50004530 CCTCTCCTCTGGAGGAAGGAAGG - Intronic
907421777 1:54352531-54352553 TTTCTCTTCTGGAGGCTGGGAGG - Intronic
909051659 1:70774689-70774711 CCTGCCTACTGGTGGCTGGCTGG + Intergenic
910576290 1:88768332-88768354 ATTCCCTTCTGGAGGATGTAGGG + Intronic
910751152 1:90632577-90632599 TCACTCTCCTGGAGGCTGGAGGG - Intergenic
911236209 1:95415165-95415187 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
911376421 1:97056969-97056991 CTACCATTCTGGAGTCTGGAAGG - Intergenic
912254960 1:108048910-108048932 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
912812241 1:112803157-112803179 GCTCCCTTCTGGGGGCTCCATGG - Intergenic
912862848 1:113230104-113230126 CCACCCCTCAGGAGCCTGGAGGG + Intergenic
914050130 1:144124540-144124562 TGTCCCTTCTGGAGGCTCAAGGG - Intergenic
914129052 1:144840911-144840933 TGTCCCTTCTGGAGGCTCAAGGG + Intergenic
914319774 1:146548027-146548049 ATTCCCTTCTGGAGGCTTGAGGG + Intergenic
915236777 1:154489175-154489197 CCCCCCTTCTGCAGGCTCGTAGG + Exonic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
917787209 1:178471679-178471701 CCTGCTTTCTGGGGGCAGGAGGG - Intronic
917839764 1:178968223-178968245 CCTTCCTTCTGGAGGCTCTAAGG - Intergenic
918249476 1:182688893-182688915 ATTCCCTTCTGGAGGCTGGAGGG - Intergenic
918555383 1:185793267-185793289 CTTACCATCTGGAGGCTGGAGGG + Intronic
919802630 1:201362729-201362751 CCTCCATTCTCGAGGGAGGAGGG - Intronic
920023013 1:202969634-202969656 CATCACTTTGGGAGGCTGGATGG + Intergenic
920083057 1:203390580-203390602 ATTCCTTTCTGGAGGCTGTAGGG - Intergenic
920097237 1:203494163-203494185 CCACCTTTCTGGAAGCTGCAGGG + Exonic
920447846 1:206033400-206033422 ATTCCTTTCTGGAGGCTGGAGGG + Intergenic
920630583 1:207647664-207647686 CCTTCCTCTTGGAGGCAGGAGGG - Intronic
920789579 1:209076929-209076951 GCTTCCTCCTGGAGGCTTGAGGG - Intergenic
920844388 1:209581747-209581769 TCACCATTCTGGAGGCTGGAAGG + Intergenic
921410843 1:214835122-214835144 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
921668951 1:217905515-217905537 ATTCCTTTCTGGAGGCTGGAGGG - Intergenic
922200358 1:223395242-223395264 CCTCTCTCCTGGAGGCCTGAGGG - Exonic
922759304 1:228116377-228116399 CCTCTCTTTTGGAGGCTTTAGGG + Intergenic
922789353 1:228302385-228302407 TCACCATTCTGGAGGCTAGATGG + Intronic
923436300 1:233970812-233970834 TCACACTGCTGGAGGCTGGAAGG - Intronic
923939287 1:238802325-238802347 TCTCAGTTCTGGAGGCTGTAAGG - Intergenic
924303353 1:242662192-242662214 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
924469147 1:244324377-244324399 CGTCCCTTCTGAGGGCTGCAAGG - Intergenic
924898410 1:248368402-248368424 CCTGCCTTATGGAGGTGGGAGGG + Intergenic
1062825865 10:568144-568166 CCTCCCTTTTGGGGGCTTGGTGG - Intronic
1063172028 10:3517580-3517602 CCACACTTCTGGATGCTGGCAGG + Intergenic
1063978205 10:11433710-11433732 ACTCCCTTCTGCAGACAGGAAGG + Intergenic
1064018488 10:11791102-11791124 CATTCCTTCTGGAAGCTCGAGGG + Intergenic
1064164485 10:12974545-12974567 CCTGCCTTCAGAAGGCTGAAAGG - Intronic
1064442305 10:15364701-15364723 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1067092479 10:43275295-43275317 GGTTGCTTCTGGAGGCTGGAGGG - Intergenic
1067980688 10:51081116-51081138 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1068105948 10:52616537-52616559 CCTTCCTTTTGGAGGCTGTAAGG + Intergenic
1069344920 10:67457675-67457697 CGTTCCTTCTGGAGGCTTTAGGG + Intronic
1069532263 10:69228129-69228151 CGTTCCTTCTGGAAGCTTGAGGG + Intronic
1069869548 10:71524860-71524882 CGTTCCTTCTGGAGGCTCCAAGG - Intronic
1070229203 10:74546015-74546037 TTTCCCTTCTGGAAGCTGGTAGG - Intronic
1070342854 10:75513617-75513639 TCTTCCCTCTGGAGGCTGTAGGG + Intronic
1070490403 10:76970671-76970693 CCTCCCTCCTGGCAGTTGGAGGG - Intronic
1070601265 10:77868022-77868044 CCTCGCTTCTGGTGGCTTGCTGG - Intronic
1072031585 10:91527037-91527059 CGTCCCTTTTGGAGGCTCTAGGG + Intergenic
1072200012 10:93149883-93149905 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1072566224 10:96618941-96618963 CCTCCCTTTTGGGGCCTGAAGGG - Intronic
1072711474 10:97718375-97718397 TGTCCCTGATGGAGGCTGGAGGG + Intergenic
1072788287 10:98299585-98299607 CTCCACCTCTGGAGGCTGGAGGG + Intergenic
1073055351 10:100696842-100696864 TGTTCCTTCTGCAGGCTGGAGGG - Intergenic
1073298516 10:102456184-102456206 CATCCCTTCTGGAGGCTCCAGGG - Intergenic
1073615494 10:104990825-104990847 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1073707532 10:106001908-106001930 CTTCCTTTCTGGAAGCTTGAGGG - Intergenic
1073952881 10:108830810-108830832 ACTCCCTTCTGGAGTCTCTAGGG - Intergenic
1074936553 10:118187615-118187637 TGTCCCTGCTGGAGGCTGCAAGG + Intergenic
1075514504 10:123098266-123098288 GGTCCCTTCTGGAGGCTCCAAGG - Intergenic
1075570428 10:123537978-123538000 TCACAGTTCTGGAGGCTGGAAGG + Intergenic
1075612024 10:123862094-123862116 TCTCCCTCCTGGAGGCTCAAGGG - Intronic
1075647604 10:124106863-124106885 GCTCCTTCCTGGAGGCTGAACGG + Intergenic
1075699421 10:124459537-124459559 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1075702723 10:124479527-124479549 TCACAGTTCTGGAGGCTGGAAGG + Intronic
1075856121 10:125631671-125631693 CCTCCCTTCTGGTGGGTAGGGGG + Intronic
1075998366 10:126895947-126895969 CCTCCCTTCTGGGTGCTGCAGGG - Intergenic
1076109541 10:127850337-127850359 CGGCCCCTCTGGAGGGTGGATGG - Intergenic
1076632106 10:131857522-131857544 GCTTCCTTCTAGAAGCTGGAAGG - Intergenic
1076683890 10:132188041-132188063 CCTCCCATCTGGAGAGGGGAGGG - Intronic
1076827500 10:132976720-132976742 CCTTCCTTCTGGGGGCTCCAGGG + Intergenic
1076916593 10:133425551-133425573 CCTCCCGTCTGGAGTCTGCCGGG - Intergenic
1076936697 10:133570346-133570368 CCTCCCGTCTGGAGTCTGCCGGG - Intergenic
1077062476 11:623954-623976 CCTCCCTTGTGGATGGTTGAGGG + Intronic
1077467539 11:2740666-2740688 GGTCCCTTCTGGAGGCTCTAGGG + Intronic
1078477508 11:11643884-11643906 TCTTCTTTCTGGAGGCTGTAGGG - Intergenic
1078483208 11:11698122-11698144 TATCACTTCTGGAGGATGGAAGG + Intergenic
1078777984 11:14411213-14411235 CATCCCTTCTGGAGGAGGGCTGG - Intergenic
1078872626 11:15363147-15363169 CCTCCCTTCTGGATGGAGGTAGG + Intergenic
1079124450 11:17708852-17708874 CCTCCCTTCTCTGGGCAGGAGGG - Intergenic
1079345613 11:19649448-19649470 TCACAGTTCTGGAGGCTGGAAGG + Intronic
1080940521 11:36912944-36912966 GCTCCTTTCTGGAGGCTCTAGGG + Intergenic
1081224037 11:40499127-40499149 CCTCCCTGCTGGAGAGAGGATGG + Intronic
1082081913 11:48018919-48018941 CCTCGCCTCTGCAGGCTGGTGGG + Intronic
1082222763 11:49661091-49661113 GCTTCTTTCTGGTGGCTGGAGGG + Intergenic
1082897340 11:58205804-58205826 CCTCTTTTCTGGATGCTGAATGG - Intergenic
1083177553 11:60960792-60960814 CCTTCCTTCTGGGGGTAGGACGG + Intergenic
1083685561 11:64373120-64373142 CCTCCCCTCTGGAGGCTCATTGG + Intergenic
1083830333 11:65227839-65227861 CCTCCTTTCTGGAGGCTCTGGGG + Intergenic
1083832526 11:65241874-65241896 CCTCCCTTCTGGCTTCAGGAGGG + Intergenic
1084434783 11:69132394-69132416 CCTCTCTTCGTGAGCCTGGATGG + Intergenic
1084660420 11:70543397-70543419 TCTCCTCCCTGGAGGCTGGAGGG - Intronic
1084696046 11:70756182-70756204 CCTCCAGCCTGGAGTCTGGAAGG - Intronic
1084715191 11:70869200-70869222 TCACCGTTTTGGAGGCTGGAAGG - Intronic
1084845685 11:71897872-71897894 CCTGCCTTTTGAAGGCTGAATGG - Intronic
1085196395 11:74674642-74674664 CTTCCTTTCTGGAGACTGGAGGG + Intergenic
1085299653 11:75450610-75450632 GCTTTCTTCTGGAGGCTGCAAGG - Intronic
1085390230 11:76178580-76178602 CCTGGCTGCTGGAGGCAGGACGG - Intergenic
1085622609 11:78048844-78048866 CCTCCTTTCTGGAGGCTCTGGGG - Intronic
1086594429 11:88554137-88554159 ATTCCTTTCTGGAGGCTGTAGGG + Intronic
1086626283 11:88958114-88958136 GCTTCTTTCTGGTGGCTGGAGGG - Intronic
1087157775 11:94921712-94921734 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1087240411 11:95768786-95768808 GCTTCTTTCTGGAGGCTGTAGGG - Intergenic
1087271780 11:96119441-96119463 CCTTCCTTCTGGAGGCTCTAGGG - Intronic
1087662367 11:101002488-101002510 CCTTCCTTCTGGAAGCTCTAAGG + Intergenic
1088919957 11:114253584-114253606 CCTCCCTACTGGGGTCTGCAGGG - Intergenic
1088981997 11:114872222-114872244 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1089068826 11:115682792-115682814 ACTCCTTTCTGGAGGCTTGGAGG - Intergenic
1089326023 11:117657678-117657700 TCTCCCTTTTGGAAGCTGGTAGG + Intronic
1089336773 11:117730366-117730388 CATTCTTTCTGGAGGCTGTAGGG - Intronic
1090487276 11:127124962-127124984 TCACACTTCTGGAGGCTGGAAGG - Intergenic
1091146225 11:133282643-133282665 CCATCATTCTGGGGGCTGGAGGG - Intronic
1092141127 12:6184245-6184267 GTTCCCCTCTGGAGGCTGCAGGG + Intergenic
1092570834 12:9719621-9719643 ATGGCCTTCTGGAGGCTGGAGGG + Intronic
1092820667 12:12350478-12350500 CCTCCCTGCTGGTGGCCCGAGGG + Exonic
1093504816 12:19853066-19853088 TCACAGTTCTGGAGGCTGGAAGG + Intergenic
1093516347 12:19990962-19990984 CATTTCTTCTGGAGGCTTGAGGG - Intergenic
1096094102 12:48923392-48923414 CTTCCCTGATGGAGGCTGAAAGG + Intronic
1096353675 12:50921245-50921267 CCTCTCTTCTGGATGCTTCAGGG - Intergenic
1096526587 12:52213552-52213574 CTTCCCTCCTTGAGGCTGGCTGG + Intergenic
1097008790 12:55938011-55938033 TTTCCCTTCTGGAGGGTGGTCGG + Exonic
1097107060 12:56632194-56632216 CCTTCCTTCTGGAGAAAGGAGGG + Intronic
1097184502 12:57189370-57189392 TTTCCCTTATGGAGGCTAGAAGG + Intronic
1097976616 12:65693330-65693352 CATACCTTCTGGAGGCTGGAGGG + Intergenic
1098708293 12:73719760-73719782 ATTCCCTTCTGGAGCCTCGAGGG - Intergenic
1098999008 12:77154995-77155017 CATTCTTTCTGGAGGCTGTAGGG + Intergenic
1099257517 12:80332065-80332087 CATTCCTTCTGGAGGCTCTAAGG - Intronic
1099926997 12:89030619-89030641 CTCACATTCTGGAGGCTGGAAGG - Intergenic
1100353185 12:93804015-93804037 GCTCCCTTTTGGAGGCTCTAAGG - Intronic
1100886233 12:99073646-99073668 ACTCCCTTCTCAAGGCTAGAAGG - Intronic
1101430354 12:104621705-104621727 CGTTCCTTCTGGAGGCTCCAAGG - Intronic
1102101437 12:110281525-110281547 CCTCCCTTCTGGCGAGGGGAGGG + Intronic
1102348584 12:112175430-112175452 TCTCAGTTCTGGAGGCTGGAAGG - Intronic
1102559436 12:113751813-113751835 GCTCCCTTCTGGTGACTGGCAGG + Intergenic
1102593305 12:113973693-113973715 GCTTCCCTCTGGAGGCTGCAGGG + Intergenic
1103415251 12:120738758-120738780 CCTCCCTTCTGTCCCCTGGAGGG + Intronic
1103841380 12:123868009-123868031 CCTCCCTGCTTGAGGATGGAAGG + Exonic
1104006456 12:124896214-124896236 CATCCCTTCTGGAAGCTCTAGGG + Intergenic
1104510942 12:129377270-129377292 TCACAGTTCTGGAGGCTGGAAGG - Intronic
1105432256 13:20347353-20347375 CCACAGTTCTGGAGGCTGGGAGG - Intergenic
1107215274 13:37910245-37910267 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
1108024990 13:46168422-46168444 CCTCGCTCCTGGGGGCTGGGGGG + Intronic
1109147330 13:58795950-58795972 CATTCCTTCTGCAGGCTGTAGGG - Intergenic
1111334284 13:86800846-86800868 CTACCATTCTGGAGTCTGGAGGG - Intergenic
1111501109 13:89120961-89120983 GTTCCCTTCTGGAGGCTCCAGGG - Intergenic
1111886537 13:94028698-94028720 CCTGCCCTCTAGAGACTGGAAGG - Intronic
1111926577 13:94469553-94469575 CCACAGTTCTGGAGGATGGATGG - Intronic
1112191349 13:97180931-97180953 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1112332798 13:98489628-98489650 CCTCCCTCCTGGAGGTTAGACGG - Intronic
1112987385 13:105467970-105467992 CATGCCTTCTGGAGGCTCCAGGG + Intronic
1113472431 13:110556414-110556436 ATTCCTTTCTGGAGGCTGAAGGG - Intronic
1113864363 13:113511569-113511591 CCTCCCTGCTAGACGCTGGACGG + Intronic
1114252285 14:20971574-20971596 CCTGCCCTCTGCTGGCTGGAAGG + Intergenic
1114551692 14:23536212-23536234 CCCCCATTCTGGCTGCTGGATGG - Intronic
1115068544 14:29294812-29294834 CTACCATTCTGGAGTCTGGAGGG - Intergenic
1116210175 14:41928356-41928378 GCTTCTTTCTGGTGGCTGGAGGG - Intergenic
1116870428 14:50064474-50064496 CCACAGTTCTGGAGGCTGGGAGG - Intergenic
1117009307 14:51454062-51454084 CCTCCCTGCTGGCTGCTGGCGGG - Intergenic
1118596919 14:67442848-67442870 CTTCCCTTTGGGAGGCTGGAAGG - Intergenic
1118812299 14:69284260-69284282 ACTCGCCTCTGGAGTCTGGAGGG - Intronic
1119783113 14:77291653-77291675 CCTCCCTCTAGAAGGCTGGATGG - Intronic
1120078614 14:80188852-80188874 TCTCCCTGCAGGAAGCTGGATGG - Intergenic
1120507744 14:85374576-85374598 CCACAGTTCTGGAGGCTGGGAGG - Intergenic
1120650093 14:87121978-87122000 CCAGCCCTCTGGAGGCAGGAAGG - Intergenic
1120688785 14:87569191-87569213 TTTCCCTTCTGGAGGCTCTAGGG - Intergenic
1120878951 14:89399689-89399711 CCTTCCTTCTGGAAGGGGGAGGG + Intronic
1121449655 14:93999074-93999096 CCTCCCCTCTGGGGGCTGGTGGG + Intergenic
1121742675 14:96265086-96265108 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1121855451 14:97265501-97265523 GATCAGTTCTGGAGGCTGGAAGG + Intergenic
1122005662 14:98701504-98701526 CTTCCCTTCTGGAGGCTGGTGGG + Intergenic
1122261954 14:100528803-100528825 ACTTCTTTCTGGAGGCTGGAGGG - Intronic
1122346944 14:101066640-101066662 CCTCCATCCTGGAGGCGGGTGGG + Intergenic
1122840938 14:104462200-104462222 CCTCTCCTGTGGGGGCTGGAGGG - Intergenic
1123419992 15:20123803-20123825 TGTCCCTTCTGGAGGCTCAAGGG - Intergenic
1123445869 15:20329729-20329751 TGTCCCTTCTGGAGGCTCAAGGG + Intergenic
1123529213 15:21130339-21130361 TGTCCCTTCTGGAGGCTCAAGGG - Intergenic
1123970615 15:25504705-25504727 CCACAGTTCTGGAGGCTGGAAGG + Intergenic
1124126408 15:26941649-26941671 TCACACTTCTGGAGGCTGGAAGG + Intronic
1124156840 15:27233427-27233449 TCACGGTTCTGGAGGCTGGAAGG + Intronic
1124206346 15:27724228-27724250 TCACAATTCTGGAGGCTGGAAGG + Intergenic
1124642749 15:31406684-31406706 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1124663214 15:31568116-31568138 CTACCATTCTGGAGTCTGGAAGG - Intronic
1125168750 15:36741595-36741617 TCACAGTTCTGGAGGCTGGAAGG + Intronic
1125594924 15:40878770-40878792 CATCCTTTCTGCAGGCAGGAGGG + Intergenic
1126405691 15:48320395-48320417 CCTCCCTTCTAGAGGCTCTGAGG - Intergenic
1126729561 15:51668826-51668848 CCTTCCTTCTGGAGACAGTAGGG - Intergenic
1127023971 15:54782048-54782070 CCTCCGTTGCCGAGGCTGGACGG - Intergenic
1127892821 15:63270161-63270183 GGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1127912212 15:63426670-63426692 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1128074139 15:64815934-64815956 TCTCCCTTCTGCAGCCTGAAAGG + Exonic
1128625712 15:69200864-69200886 GTTCCTTTCTGGAGGCTGTAGGG + Intronic
1129941971 15:79506014-79506036 CCCTCCTTCTGGAGGCTCTAGGG + Intergenic
1130053231 15:80501614-80501636 CCTGCCTCCTGGCTGCTGGAGGG - Intronic
1130135642 15:81179608-81179630 ACTTCTTTCTGGAGGCTAGAAGG + Intronic
1130303053 15:82694747-82694769 TCACAGTTCTGGAGGCTGGAAGG + Intronic
1131239808 15:90729430-90729452 GTTCCCTTCTGGAGGCTCAAGGG + Intronic
1131410246 15:92201335-92201357 CTACCATTCTGGAGTCTGGAGGG - Intergenic
1131453544 15:92565665-92565687 CTACCATTCTGGAGTCTGGAGGG + Intergenic
1131660594 15:94511608-94511630 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1133209950 16:4258014-4258036 TCTCCCTTCTGGGGGCTGGAGGG - Exonic
1133407555 16:5537495-5537517 CTTCCTTACTGGAGGCTGGAGGG + Intergenic
1133924926 16:10184283-10184305 TCTCACTTCTTGAGGCTGGGAGG - Intergenic
1134217498 16:12327390-12327412 CTCACCTTCCGGAGGCTGGAAGG + Intronic
1134783326 16:16918400-16918422 CATTCCATCTGGAGGCTTGAGGG + Intergenic
1134905042 16:17972650-17972672 CCGTTCTTCTGGAGGCCGGATGG + Intergenic
1134905848 16:17978874-17978896 CGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1135532246 16:23264797-23264819 CATCTCTTCTGGAGGCTTTAGGG + Intergenic
1135624147 16:23981181-23981203 CCTTCCTTCTGGAGGCTCTAGGG + Intronic
1135648269 16:24182705-24182727 CCTCCCATCTGTGGGCTGGAGGG + Intronic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1136278751 16:29194720-29194742 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1136682746 16:31977521-31977543 CCTGCCTTCTGGGGTCTTGAGGG + Intergenic
1136720893 16:32318952-32318974 TGTCCCTTCTGGAGGCTTAAGGG - Intergenic
1136783384 16:32921087-32921109 CCTGCCTTCTGGGGTCTTGAGGG + Intergenic
1136839275 16:33525238-33525260 TGTCCCTTCTGGAGGCTTAAGGG - Intergenic
1137330492 16:47490545-47490567 CCTCTTTTCTGGAGGCTCCAGGG + Intronic
1138506983 16:57483250-57483272 CATTCCTTCTGGAGGATGGTGGG - Intronic
1139052453 16:63142611-63142633 CCACACTTTTGGAGGCTGGAAGG - Intergenic
1139478163 16:67213532-67213554 CCTTCATTCTGGAGCCTGGCTGG + Intronic
1139950866 16:70668839-70668861 TCACAGTTCTGGAGGCTGGAAGG - Intronic
1140013754 16:71162050-71162072 ATTCCCTTCTGGAGGCTTGAGGG - Intronic
1140034452 16:71361621-71361643 CACCCCTTCTGGATGCTGGCTGG + Intronic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1140484548 16:75283257-75283279 CCTCCTTTCTGGAGGCCCAAGGG - Intergenic
1140503872 16:75457542-75457564 CCTCAGTTCTGGAGGCTGGAAGG - Intronic
1140642342 16:76990891-76990913 ATTCCTTTCTGGAGGCTGCAAGG + Intergenic
1140794195 16:78421259-78421281 GGCTCCTTCTGGAGGCTGGAAGG + Intronic
1140858023 16:78994894-78994916 ACTCCCTTCTGGACACTGGAAGG + Intronic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1141343295 16:83223265-83223287 CCTGTCTTCTGGAGGGTGCAAGG - Intronic
1141405162 16:83786053-83786075 CCTCCTCTCTGGAGGAGGGATGG - Intronic
1141739186 16:85879272-85879294 ACTCCCATCTGGAGGCTGTGGGG + Intergenic
1141953278 16:87353105-87353127 GCTGCCTCCTGGAGGCTGCAGGG + Intronic
1142083142 16:88160801-88160823 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1142211152 16:88809163-88809185 AGTCCCTTCTGGAGGCTCCAGGG - Exonic
1203005539 16_KI270728v1_random:198818-198840 TGTCCCTTCTGGAGGCTTAAGGG + Intergenic
1203086035 16_KI270728v1_random:1185071-1185093 CCTGCCTTCTGGGGTCTTGAGGG + Intergenic
1203137089 16_KI270728v1_random:1734939-1734961 TGTCCCTTCTGGAGGCTTAAGGG + Intergenic
1203149440 16_KI270728v1_random:1825523-1825545 TGTCCCTTCTGGAGGCTTAAGGG - Intergenic
1142537721 17:631333-631355 CCTCTCTTTCTGAGGCTGGAAGG + Intronic
1142563994 17:827732-827754 CCTCCCTGCTGGGGGCTTGAGGG + Intronic
1143305935 17:5946782-5946804 CCACCCTTCTCCAGGATGGAAGG - Intronic
1143602399 17:7956754-7956776 GCTGCCTACTTGAGGCTGGAGGG - Intergenic
1143813143 17:9488693-9488715 TCTTCCTTCTGGAGGATGTAGGG - Intronic
1143993038 17:10982908-10982930 CCTCACTTCTGGAGGTTTGCTGG + Intergenic
1143997879 17:11023769-11023791 CCTGGCTTCTGGAGGGGGGAGGG - Intergenic
1146593935 17:34153627-34153649 CCTCCCTGCTGGAGCCTCGTTGG + Intronic
1146641667 17:34546650-34546672 CCTCTCAGCTGGTGGCTGGATGG - Intergenic
1147322772 17:39656269-39656291 CCTCCCTTCTCCAGGGTGGCTGG + Intronic
1147361534 17:39933819-39933841 CCTCCCTTCAGGAAGCAGGTGGG - Intergenic
1147419714 17:40316548-40316570 CTTCCTTCCTTGAGGCTGGAGGG - Intronic
1147573455 17:41585655-41585677 CCTCCCTGCTGGAGTCTGTTGGG - Intronic
1147644379 17:42025077-42025099 CCTGCCCCCTGGTGGCTGGAGGG - Exonic
1147774245 17:42889368-42889390 GCTCAGTTCTGGAGGCTGGAAGG + Intergenic
1147774566 17:42891588-42891610 CCTCTCTTCTTTAGGGTGGAAGG - Intergenic
1148157572 17:45432511-45432533 CCCTCCATCTGGGGGCTGGAGGG - Intronic
1148227901 17:45911864-45911886 CCACCTTCCTGGAGGGTGGAGGG + Intronic
1148993190 17:51684240-51684262 CATTCTTTCTGGAGGCTGTAGGG - Intronic
1149789719 17:59466468-59466490 CCTCGCTTCTGGTGGCTTGCTGG - Intergenic
1150375094 17:64674419-64674441 CCTTCCTTCTGGAGGTTCTAGGG - Intergenic
1150597560 17:66619771-66619793 CCTCCCTTTTGGAGGTTTAAAGG - Intronic
1150965589 17:69964438-69964460 CTTCCCTTCTGGAGACTCTAAGG + Intergenic
1151325730 17:73378937-73378959 CCTGCCCTCAGGAAGCTGGAGGG + Intronic
1151343229 17:73485225-73485247 CCTCCCTCCTGAGGGCAGGAAGG + Intronic
1151874977 17:76862857-76862879 CCTACCTTCTGAAGGCTTCAAGG - Intergenic
1151991485 17:77577758-77577780 AGTTCCTTCTGGAGGCTGTAGGG + Intergenic
1152143188 17:78550655-78550677 TCACAGTTCTGGAGGCTGGAAGG - Intronic
1152145502 17:78566124-78566146 TCTCAGTTCTGGAGGCTGGGAGG - Intronic
1152622521 17:81372421-81372443 CCTCCCTTCTTGAGGCTTCCAGG + Intergenic
1152794595 17:82300956-82300978 CCTGCCCTCTGGTGGCGGGACGG - Intergenic
1154088113 18:11327234-11327256 CATTCCTTCAGGAGGCTGTAGGG - Intergenic
1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG + Intergenic
1155109492 18:22699839-22699861 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1155288680 18:24319151-24319173 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1155498352 18:26464221-26464243 CCTTCCTTCTGGAGGCTCTGGGG + Intronic
1156241233 18:35256661-35256683 GCTCAAGTCTGGAGGCTGGAGGG + Intronic
1156259332 18:35430075-35430097 CTTCCTTTCTGGAGGCTCTAGGG + Intergenic
1156512795 18:37655301-37655323 TCAGCCTCCTGGAGGCTGGAAGG - Intergenic
1157795932 18:50575206-50575228 CCTCCCCTCTGGAGGATGCAGGG + Intronic
1159016287 18:63104124-63104146 CCTCTCTGCTGCAGGGTGGAGGG + Intergenic
1159017282 18:63111475-63111497 CCTCCCTTCTGGAGGCCCTAGGG - Intergenic
1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG + Intronic
1160139386 18:76307543-76307565 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1160498179 18:79387316-79387338 CCTCAGTTCTGGAGGCCAGAAGG + Intergenic
1160657942 19:282868-282890 CCTCCCTTCTGTGGGCGGGGCGG - Intronic
1160662193 19:306335-306357 CCTCGCCTCTGCTGGCTGGAAGG + Exonic
1160689490 19:454848-454870 CGTCCCCTCTGGAGGCAGCAGGG + Intronic
1161018728 19:1997563-1997585 CATGCCTGCTGGAGGCTGGCAGG - Intronic
1161079809 19:2305178-2305200 CCTGCCTTCTGGGGCGTGGAAGG + Intronic
1161727394 19:5937763-5937785 CTGCCCTGCTCGAGGCTGGAGGG + Intronic
1161874052 19:6893870-6893892 CGTTCCTTCTGGATGCTGTACGG + Intronic
1163704133 19:18802623-18802645 AGTCCCCTCTGGAGGTTGGAGGG + Intergenic
1164456558 19:28412179-28412201 ACTCTATACTGGAGGCTGGAGGG + Intergenic
1164761751 19:30733401-30733423 CCTTCCTCCTTCAGGCTGGAGGG - Intergenic
1165409275 19:35648828-35648850 CCTCCCTTTTGGACGTTGGAGGG + Intronic
1165434395 19:35788279-35788301 CCCCCCTTCCGTAGGCTGGCGGG - Exonic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1165909340 19:39215187-39215209 CCTTCCTTCTGGAGGCTCCAGGG + Intergenic
1166246558 19:41531624-41531646 CCTCTCTCCTGGGGGCGGGAGGG - Intergenic
1166530716 19:43541701-43541723 CGTTCCTTCTGGAGGCTTGAGGG - Intergenic
1166915885 19:46195986-46196008 CCTCCATTCTGGAGGAGAGAGGG + Intergenic
1166925158 19:46261803-46261825 CCTCCATTCTGGAGGAGAGAGGG - Intergenic
1167012682 19:46819266-46819288 CATCCCTTCTGGAGACTCTAGGG - Intergenic
1167192468 19:48001016-48001038 CATTCCTTCTGGAGGCTGTAGGG + Intronic
1167529019 19:50003223-50003245 GATTCCTTCTGGAGGCCGGAGGG - Intronic
1167613049 19:50516627-50516649 CCACAGTTCTGGAGGCTGGAGGG - Intergenic
1167754673 19:51404721-51404743 CCTCTCTTATGGAAGGTGGAAGG + Intergenic
1168180389 19:54658729-54658751 CCTCCCTTCTGGCTGCTGTGTGG + Intronic
1168507827 19:56951251-56951273 TCACTGTTCTGGAGGCTGGAAGG - Intergenic
1168646895 19:58065147-58065169 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1202689519 1_KI270712v1_random:77103-77125 TGTCCCTTCTGGAGGCTCAAGGG - Intergenic
925227742 2:2200354-2200376 CCTTCCTTGTGGAGGCTCCAAGG + Intronic
925497244 2:4465832-4465854 CTTCCCTTCTGGAGGCTGTATGG - Intergenic
925700850 2:6636237-6636259 CCTGGCATCTGGAGGATGGATGG + Intergenic
926141920 2:10372942-10372964 CCCTCCTTCTGGGGGCAGGAGGG - Intronic
926196836 2:10769108-10769130 CCTCCCCTGTGGAGGCTGCACGG + Intronic
926218211 2:10918577-10918599 CCCCCCATCTGGGGTCTGGAGGG + Intergenic
926375573 2:12224059-12224081 CTACCATTCTGGAGTCTGGAAGG - Intergenic
926572543 2:14545097-14545119 CATCCCTTCTGGAGGCTCTAAGG - Intergenic
926889169 2:17624711-17624733 ATTCCCTTCTGGAGGCTTCAGGG - Intronic
927405947 2:22766985-22767007 TCACATTTCTGGAGGCTGGATGG + Intergenic
927904122 2:26845212-26845234 CCGGCCTTCTGGAGGCTGGCAGG + Intergenic
928194497 2:29205549-29205571 TGTCCCTTCTGGAGGCTCTAGGG + Intronic
929801305 2:45105551-45105573 GCTCCTTTCTGGAGGCTCTAGGG - Intergenic
930331999 2:49996734-49996756 CATTCCTTCTGGAGGCTTTAGGG - Intronic
930776918 2:55182035-55182057 CATTCCTTCTGGAGGCTCTAAGG - Intronic
931095766 2:58939004-58939026 CCTTTCTTCTGGAGGCTGTTGGG - Intergenic
931220338 2:60283617-60283639 CATCCTTTCTGGAAGCTGGCAGG - Intergenic
932114989 2:69037938-69037960 CCTCCCCTCTACAGGCTGCATGG + Intronic
932373044 2:71208887-71208909 CTTTCCTTCTGGAGGCTCTAGGG - Intronic
933685831 2:85140481-85140503 CCTCCATGGTGGAAGCTGGAGGG + Intronic
933704255 2:85277944-85277966 CCTACCTTCTGGGAGCCGGAGGG + Intronic
933956915 2:87378989-87379011 TGTCCCTTCTGGAGGCTCAAGGG + Intergenic
934241036 2:90270879-90270901 TGTCCCTTCTGGAGGCTCAAGGG + Intergenic
934272142 2:91545806-91545828 TGTCCCTTCTGGAGGCTCAAGGG - Intergenic
934732746 2:96669715-96669737 CTTCCCTGCTGGAGGCTGTGTGG - Intergenic
934770327 2:96903624-96903646 TCTCCCTCCAGGAGGCAGGATGG - Intronic
935012110 2:99145089-99145111 CATTCCTTCTGGAGGCTCTAGGG + Intronic
935262682 2:101368869-101368891 CCACAGTTCTGGAGGGTGGAAGG - Intronic
935374021 2:102377266-102377288 CTTTACTTCTGGAGGCTGTAGGG + Intronic
935439552 2:103076188-103076210 ACACCCCACTGGAGGCTGGAGGG + Intergenic
937113317 2:119384375-119384397 TGTTCCTTCTGGAGGCTGTAGGG - Intergenic
937530654 2:122823310-122823332 CCTTCTTTCTGGAGGCTCTAGGG - Intergenic
937956856 2:127426569-127426591 GTTCCCATGTGGAGGCTGGAGGG - Intronic
938042720 2:128089633-128089655 TCGCCCTGCTGGAAGCTGGAGGG - Intergenic
938722619 2:134079851-134079873 TCACCCTTCTGAAGGTTGGAAGG + Intergenic
938728635 2:134129138-134129160 ATTCCTTTCTGGAGGCTTGAAGG + Intronic
939162147 2:138603524-138603546 CCACGGTTCTGGAGGCTGGGAGG + Intergenic
940803331 2:158156851-158156873 CCTCCCATATTGAAGCTGGATGG - Intergenic
941281255 2:163554486-163554508 CCTCTCTTCTTCAGGCTCGAAGG - Intergenic
941468479 2:165857212-165857234 CCTTCCTTCTGCAAGCTGTAGGG - Intergenic
942171440 2:173293563-173293585 CCTCTCTTCTGGATGCTTCAGGG + Intergenic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
942770627 2:179514150-179514172 CATTCCTTCTGGAGGCTTTAAGG + Intronic
943148603 2:184079629-184079651 TCCTCATTCTGGAGGCTGGAAGG + Intergenic
945369612 2:209000789-209000811 CATCCCTTCTGGAAGTTTGAGGG + Intergenic
945742936 2:213685487-213685509 CCACACTTCTGGAGGCCAGAAGG - Intronic
946308249 2:218868337-218868359 CCTCCCTTAAGAAGGCAGGAGGG - Intronic
946396600 2:219446471-219446493 CCTCCCTGCAGGTGGCTGGCTGG + Intronic
946707539 2:222473268-222473290 TATTTCTTCTGGAGGCTGGAGGG + Intronic
947665676 2:231904104-231904126 CTTCCCTCCTGGATGCTTGAAGG - Intergenic
947799743 2:232921325-232921347 CCTGCCTGCTGCAGGCTGGGAGG + Intronic
948254571 2:236556600-236556622 CCTTCCTTCTGGAGGCTTTGGGG - Intergenic
948371902 2:237494984-237495006 CATTCCAGCTGGAGGCTGGAGGG + Intronic
948434954 2:237946834-237946856 CATTCCTTCTGGAGGCTTCAGGG + Intergenic
948439952 2:237980334-237980356 TTTCCCTTCTGGAGGCTGGAAGG + Intronic
949031205 2:241798344-241798366 TCACCGTTCTGGAGGCCGGAAGG + Intronic
1168753728 20:301289-301311 CCTCCCTCCTGGAGAGTGGGGGG - Intergenic
1168892408 20:1303497-1303519 CCCCCCACCTGGAGGCAGGAAGG + Intronic
1169105158 20:2988268-2988290 CCCCTCTTCTGGAGGCTAAACGG - Intronic
1169659969 20:7967694-7967716 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1171465036 20:25321399-25321421 CCTCCTTTCAGGAAGCTGGTGGG + Intronic
1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG + Intronic
1172207683 20:33176093-33176115 CCTCCCAACTGGAGGCAAGAAGG - Intronic
1172786340 20:37471311-37471333 CCTAGCTTCTGGAGGTTGGCTGG - Intergenic
1173052345 20:39575575-39575597 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1173162913 20:40665565-40665587 CTTCAATTCTGGAGGCTGTAGGG + Intergenic
1173190753 20:40873939-40873961 CCTTCCTTCTGGAGGATCTAGGG - Intergenic
1173281986 20:41636874-41636896 TATTCCTTCTGGAGGCTGTAGGG - Intergenic
1173428313 20:42961998-42962020 CATTCCTTCTGGAGGCTGTAGGG - Intronic
1173572232 20:44084914-44084936 TCTCAGTTCTGGAGGCTAGAAGG - Intergenic
1174552882 20:51374328-51374350 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1175084942 20:56450629-56450651 CCTGCCTTCTTGGGGCTGGCTGG - Exonic
1175285285 20:57833562-57833584 CCTCCTCTCTGTAGGCTGGTGGG - Intergenic
1175334265 20:58184952-58184974 CATCCCTTCTGGAGGCTCTGGGG - Intergenic
1175617259 20:60411252-60411274 TCACAGTTCTGGAGGCTGGAAGG + Intergenic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1176063855 20:63184030-63184052 CTTCCCTTCTGGAAGCTGGAGGG + Intergenic
1177644956 21:23889109-23889131 TCTCAGTTCTAGAGGCTGGAGGG - Intergenic
1179114801 21:38480390-38480412 GGTCCCTTCTGGAGGCTGTGAGG - Intronic
1179491299 21:41743229-41743251 CCTCCTTTCTGCCGGCTGCAGGG - Intronic
1179588219 21:42387535-42387557 CCTCAGGGCTGGAGGCTGGAGGG + Intronic
1179597955 21:42455751-42455773 CCTCCCGTCTGGAGGCCAGTAGG + Intergenic
1179719676 21:43307968-43307990 CCTTCCGTCTGGAGGAGGGAGGG - Intergenic
1180128788 21:45811301-45811323 CATCCCTTCTGGAGGCTCACGGG + Intronic
1180169890 21:46052539-46052561 TCTCGCATCCGGAGGCTGGAAGG - Intergenic
1180219511 21:46349287-46349309 CCTACCTTCTAAATGCTGGATGG + Intronic
1180597994 22:16991804-16991826 CCTCCTTGCTGGAGATTGGAGGG + Intronic
1180731717 22:17987363-17987385 CCTTCCTCCTGGAGGCAGCAGGG + Intronic
1180799656 22:18625842-18625864 CCTCCTTTCTGGGGGGAGGAGGG + Intergenic
1181081419 22:20418298-20418320 GCTGCCATCTGGCGGCTGGATGG - Intergenic
1181222060 22:21369424-21369446 CCTCCTTTCTGGGGGGAGGAGGG - Intergenic
1181316537 22:21974321-21974343 ACTCCCTTCAGTAGGATGGAGGG + Intronic
1181352127 22:22266565-22266587 TGTCCCTTCTGGAGGCTCAAGGG - Intergenic
1181450996 22:23020621-23020643 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
1181592366 22:23893354-23893376 CCTCCCAGCTGGAGGCTGGCTGG + Intronic
1182130334 22:27845704-27845726 GCTCCCTTCTGGATGCTGGCAGG + Intergenic
1182154133 22:28053221-28053243 CATCCCTTCAGGATGCAGGATGG + Intronic
1182763751 22:32743756-32743778 CTTCCCTCCTGGAGACTGGGCGG + Intronic
1183099492 22:35575178-35575200 GCTCCCCTCTGGAGGCTGAGAGG - Intergenic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1183622319 22:38981823-38981845 CCCACCTTCTGGAAGCTGGGAGG + Intronic
1183627485 22:39013722-39013744 CCCACCTTCTGGAAGCTGGGAGG + Intergenic
1184034722 22:41913024-41913046 CCTGGCTTCTGGATGCTGCAGGG - Intronic
1184182170 22:42837034-42837056 GCTCCTTTCTGGAGTTTGGAGGG + Intronic
1184915180 22:47564089-47564111 CCTCCCTTCTGCAGGTGGGTGGG + Intergenic
949092243 3:42037-42059 CAGTCCTTCTGGAGGCTGTAAGG + Intergenic
949510193 3:4760647-4760669 GCTCCTTTCTGGAGGCTCTAGGG + Intronic
950132145 3:10554573-10554595 CATTCCTTCTGGAGGCTGCGGGG - Intronic
950132808 3:10558907-10558929 CCTCACTCCTGGAGGGTGCAGGG - Intronic
950580056 3:13856074-13856096 CCTACCTTCTGCAGGGTGGGAGG - Intronic
951873054 3:27387804-27387826 CCTCTCTTCTGGAGGTTTGCTGG - Intronic
952235018 3:31470562-31470584 TCCCCATTCTGGAGGCTAGAAGG + Intergenic
952454430 3:33459617-33459639 CCTCTCTTCTGGATGCTTCAGGG + Intergenic
952457246 3:33484795-33484817 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
952596757 3:35027871-35027893 CCACCATTCTGGGGTCTGGAGGG + Intergenic
952920877 3:38283018-38283040 CTTCCTTTCTGGAGGCTCTAGGG + Intronic
953285106 3:41598937-41598959 ACTCCTTTCTGGAGGCTCCAGGG + Intronic
953441315 3:42920494-42920516 CCTCTCTTCTGGATGCTCCAGGG + Intronic
953808659 3:46093484-46093506 CCTTCCTGCTGGATTCTGGATGG + Intergenic
954295241 3:49670848-49670870 CTTGCCTTCTGGAGCCTGTAGGG + Exonic
954747275 3:52794380-52794402 CCTCCCTTCTTGAGGCAGCCAGG - Intergenic
954774004 3:52999538-52999560 CTTCCCCTCTGGAAGCTGAAGGG - Intronic
954873345 3:53784551-53784573 CCTCTACTCTGGAGGCTGAAGGG + Intronic
955004015 3:54952707-54952729 TTTCCCATCTGGAAGCTGGAGGG - Intronic
955325605 3:58007713-58007735 ATTCCCTTCTGGAGGCTGTAGGG - Intergenic
955906092 3:63809251-63809273 GCTACCTTCTGGAGGCTGGAGGG - Intergenic
956395736 3:68824314-68824336 CCTGCCTTCTGGAGGCCCTAAGG + Intronic
957541918 3:81582414-81582436 CATTTCTTCTGGAGGCTGTAAGG - Intronic
957716229 3:83932639-83932661 CCTCTCTTCTGGATGCTTCAGGG - Intergenic
957909960 3:86607862-86607884 CCACTGTTCTGGAGCCTGGAGGG + Intergenic
958730557 3:97956322-97956344 CATTCCTTCAGGAGGCTGTAGGG - Intronic
959838902 3:110951430-110951452 CTACCATTCTGGAGTCTGGAGGG - Intergenic
960054912 3:113270264-113270286 CCTCCTTCCTGGAGGCTTGCAGG + Intronic
960437731 3:117647682-117647704 CCTCCAGTCTGGAGGCCTGAGGG - Intergenic
960636935 3:119793466-119793488 GCTGCCTTCTGGAGGCTGTAGGG + Intronic
960757119 3:121027473-121027495 ACTTCTTTCTGGAGGCTGTAGGG + Intronic
960937195 3:122911509-122911531 CCTCCATGCTGGAGGCTGGCAGG + Exonic
961378954 3:126484782-126484804 CCTCCCACCTGGAGGCTGGTGGG - Intronic
961492387 3:127264821-127264843 CCTCCTTTCTGGAGCCTACATGG - Intergenic
961768617 3:129231795-129231817 CCTCCACTCTGCAGCCTGGATGG - Intergenic
961831346 3:129624531-129624553 CCGCTGTTCTGGAGGCTGCAAGG + Intergenic
962414198 3:135167691-135167713 TCTGCTTTCTGGAGGCAGGAAGG - Intronic
962528563 3:136257377-136257399 GCTCCCTTCTGGAGGCTCCAGGG - Intronic
962644948 3:137429117-137429139 TGTTTCTTCTGGAGGCTGGAGGG + Intergenic
964206427 3:154179967-154179989 GTTTCCTTCTGGAGGCTGTAGGG + Intronic
964479483 3:157127570-157127592 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
964525743 3:157613943-157613965 CCACAGTTCTGGAGGTTGGAGGG + Intronic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
965454342 3:168879154-168879176 TGTTCCTTCTGGAGGCTTGAGGG - Intergenic
965622827 3:170657889-170657911 GGTTCCTTCTGGAGGCTGTAGGG + Intronic
965656331 3:170989196-170989218 CCTCCCTTTGTGAGACTGGACGG + Intergenic
966688134 3:182718220-182718242 CCTCTCTTCTGGATGCTCCAGGG + Intergenic
966971815 3:185051387-185051409 CCTCTCTTCTGTAACCTGGAAGG - Intronic
967288936 3:187900627-187900649 AGTTCCTTCTGGAGGCTGTAGGG + Intergenic
967469851 3:189848965-189848987 TCTCCTTCCTGGAGGCTGGGGGG - Intronic
967637907 3:191825825-191825847 CATCCCTTCTTGAGGGTGGAGGG + Intergenic
967854463 3:194106263-194106285 TCACAGTTCTGGAGGCTGGAAGG + Intergenic
968751815 4:2393978-2394000 CGTGCCTTCTGGAGGCTCCAGGG + Intronic
969045024 4:4330414-4330436 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
969077612 4:4592749-4592771 TGTTCCTTCTGGAGGCTCGAGGG + Intergenic
969197933 4:5577927-5577949 CCTCCCTTCTTGAGGTGGGCTGG - Intronic
969240970 4:5897273-5897295 CCTTCCTTCTGGAGGCTCCAGGG - Intergenic
969365835 4:6693891-6693913 CCTTCCTCCTGGGGGCTGGCAGG - Exonic
969621317 4:8280297-8280319 CCTCCCTCCTGGAGGGAGGAGGG + Intronic
969854993 4:9991836-9991858 TCACAGTTCTGGAGGCTGGAAGG - Intronic
971574107 4:28252209-28252231 GCTCCTTTCTGGAGGCTCTACGG + Intergenic
971689330 4:29812468-29812490 CATTCCTGCTGGAGGCTGTAGGG + Intergenic
972102138 4:35433021-35433043 CGTTCCTTCTAGAGGCTGTATGG - Intergenic
973214996 4:47658431-47658453 CTACCATTCTGGAGTCTGGAGGG + Intronic
974138693 4:57853210-57853232 CTTGCCATCTGGAGACTGGATGG - Intergenic
974214204 4:58824021-58824043 ATTCCCTTCTGGAGGCTGTAAGG + Intergenic
974651164 4:64755485-64755507 CCACCATTCTGGGGCCTGGAGGG - Intergenic
976771911 4:88662277-88662299 CCTCCATTCTGAAGGGTGGAGGG + Intronic
978352426 4:107833979-107834001 GCTCCTTTCTGGAGGCTCCACGG - Intronic
979696902 4:123622783-123622805 TCTACCTCCTGGTGGCTGGAAGG + Intergenic
980910518 4:138989834-138989856 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
981099239 4:140812134-140812156 TCACAGTTCTGGAGGCTGGAAGG + Intergenic
981291132 4:143076899-143076921 CATTCCTTCTGGAGGCTTAAGGG - Intergenic
982320619 4:154073188-154073210 CATTCCTTCTGGAGGCTCAAGGG - Intergenic
982542540 4:156692110-156692132 CCTCCCTTGTGGAACCTGGTGGG - Intergenic
983327793 4:166281140-166281162 CCTCCCTTCTGAATGCAGCAGGG + Intergenic
984285353 4:177721727-177721749 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
984454321 4:179945448-179945470 CTACCATTCTGGAGTCTGGAGGG - Intergenic
984490260 4:180425451-180425473 CCACACTTCTGGAGGAAGGAAGG - Intergenic
985024581 4:185728160-185728182 CTTCCATTATGGAGCCTGGAAGG + Intronic
985090479 4:186357899-186357921 CCTTCCTTCTGGAGGCTCCTGGG - Intergenic
985946575 5:3189387-3189409 CCTCCCTTTTTGAGACTGTATGG - Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG + Intergenic
986202630 5:5591869-5591891 CCTCCCTTCTTTAGAATGGAAGG + Intergenic
986246495 5:6011931-6011953 CCTTCCTTCTGGCTGCTGCATGG + Intergenic
986377345 5:7145831-7145853 CATCTCTTCAGGAGGCTGAAAGG - Intergenic
986947812 5:13046241-13046263 TCTCCCTTGTGGAGGGTGGAGGG + Intergenic
987835042 5:23149837-23149859 TCACATTTCTGGAGGCTGGAGGG + Intergenic
987899977 5:23998808-23998830 GCTTCCTTCTAGAGGCTGTAGGG + Intronic
988255270 5:28810623-28810645 CTTTCCTTCTGGAGGGCGGAGGG + Intergenic
989610590 5:43286996-43287018 GCTCCTTTCTGGAGGCTCCAGGG + Intergenic
989646547 5:43639611-43639633 CCTCCCATATGCAGGGTGGATGG - Intronic
989729676 5:44633687-44633709 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
990346952 5:54880803-54880825 CCTTCCTTCTAGAGGCTCTAGGG + Intergenic
990353399 5:54940965-54940987 TCTTCCTTCTGGAGGCTCTAGGG + Intergenic
990592607 5:57281595-57281617 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
991355712 5:65767078-65767100 CTACCATTCTGGAGTCTGGAGGG + Intronic
991404212 5:66285941-66285963 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
992094069 5:73344106-73344128 CCTCCCTGCAGGAGGCTGCTTGG - Intergenic
992596810 5:78355627-78355649 GTTCCTTTCTGGAGGCTCGAGGG + Intergenic
993161734 5:84300133-84300155 ATTCCCTTCTGGAGGCTAGGGGG + Intronic
993382655 5:87225262-87225284 CATTCTTTCTGGAGGCTGAAAGG - Intergenic
994327349 5:98463764-98463786 TCACCGTTCTGGAGGCTGGGAGG - Intergenic
994378700 5:99044232-99044254 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
994851721 5:105063376-105063398 GATTCCTTCTGGAGGCTGCAAGG - Intergenic
995137454 5:108695411-108695433 CCTTCCTTCTGGAGGCTCTACGG - Intergenic
995262119 5:110116362-110116384 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
995405948 5:111796095-111796117 CATGCCTTCTGGAGGCTCTATGG + Intronic
995803997 5:116030555-116030577 TCACAGTTCTGGAGGCTGGAAGG - Intronic
996081298 5:119261170-119261192 CCTCCCCTCTTAAAGCTGGATGG - Intergenic
997338193 5:133122413-133122435 CCTCTCTTCTACAGGCAGGAGGG + Intergenic
997459990 5:134045425-134045447 CCTTCATTCTGGAGGCTTTAGGG + Intergenic
997664307 5:135616246-135616268 CTTCCATTCTGGGGTCTGGAGGG - Intergenic
997879901 5:137580228-137580250 CCTGCCCTCTAGGGGCTGGAGGG + Intronic
997998533 5:138605809-138605831 CCTCCCTTCCTGAGGCAGGAAGG - Intergenic
998877814 5:146618345-146618367 GCTCCTTTCTGGAGGCTCTAGGG - Intronic
999063155 5:148656475-148656497 CTTCCTTTCTGGAGGCTTTAGGG - Intronic
999157054 5:149465439-149465461 TCTCATTTCTGGAGGCTGGCAGG + Intergenic
999447327 5:151650496-151650518 CCTTCCTTCTGGTGGCTGCATGG - Intergenic
999842999 5:155449397-155449419 CCACCATTCTGGGGTCTGGAGGG + Intergenic
999906184 5:156143448-156143470 CAACCATTCTGGGGGCTGGAGGG - Intronic
1000049084 5:157546616-157546638 CCCCCCTTCTGGAGAAGGGAAGG - Intronic
1000673426 5:164090644-164090666 CATCCCTTGGGGTGGCTGGAAGG - Intergenic
1000741079 5:164970957-164970979 CCTCTCTTCTGGATGCTCCAGGG + Intergenic
1001162200 5:169329957-169329979 CCTCCTTTCTGGAGGCTCTAGGG + Intergenic
1001621391 5:173088204-173088226 CTTCCATTCTGGAGGCTCCAGGG + Intronic
1001907523 5:175485349-175485371 CCTTCCTTCTGGAGGCTCTAGGG + Intronic
1002315224 5:178339026-178339048 GCACTCCTCTGGAGGCTGGAAGG - Intronic
1002329496 5:178431669-178431691 GCTTCCTTCTGGAGGCTCCAGGG - Intronic
1002333027 5:178458166-178458188 CCTCACTTCTGGAGGATGCTGGG + Intronic
1002392765 5:178928727-178928749 CTTACATTCTGGAGTCTGGAGGG + Intronic
1002393551 5:178935770-178935792 CCTCCTCTATAGAGGCTGGAAGG - Intergenic
1003238170 6:4317129-4317151 CCACCCTGCTGGAGGCTGTAAGG + Intergenic
1003664945 6:8102242-8102264 CCTCCCTCCAGGAGGTAGGATGG + Intronic
1004576488 6:16900660-16900682 CGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1005534042 6:26736614-26736636 TCTCAGTTCTGGAGGCTAGAAGG + Intergenic
1005536753 6:26765040-26765062 TCTCAGTTCTGGAGGCTAGAAGG - Intergenic
1005671786 6:28113666-28113688 CCTGACTTCTGGAGGCTTGAAGG - Intergenic
1005980460 6:30832355-30832377 CCACCTTCCTGGAGGCTGGGAGG + Intergenic
1006930011 6:37681849-37681871 CCTCCTTTCTGGAGACTTGAGGG - Intronic
1008547033 6:52592186-52592208 GTTCCTTTCTGGAGGCTTGAGGG + Intergenic
1008706437 6:54166018-54166040 CCACAGTTCTGGAGGCTGGGAGG - Intronic
1009007651 6:57807453-57807475 TCTCAGTTCTGGAGGCTAGAAGG - Intergenic
1009735488 6:67671617-67671639 CCTCTCTTCTGGATGCTCCAGGG + Intergenic
1010302054 6:74272764-74272786 CATTTCTTCTGGAGGCTGTAAGG + Intergenic
1011797929 6:90978036-90978058 GCTTCCTTCTGGAGGCTGTGGGG - Intergenic
1012279592 6:97313012-97313034 GGTTCCTTCTGGAGGCTGCATGG - Intergenic
1013204333 6:107933221-107933243 ACTTCCTTCTGGAGGCTCTAGGG - Intronic
1013466979 6:110426490-110426512 CCTCCCTCCAGGAGGAGGGAGGG - Intronic
1013617405 6:111858000-111858022 TCTCCCTGCTGGAGGCTGGCTGG - Intronic
1013639491 6:112059375-112059397 CCTCCCTTCTGGAGGTGGCAGGG + Intronic
1013743826 6:113320863-113320885 GCTTCCTTCTGGAACCTGGAGGG - Intergenic
1013764101 6:113554148-113554170 CTTCCTTTCTGAAGGTTGGAGGG + Intergenic
1015717244 6:136205465-136205487 CCTCCCATCTGCAGGGGGGATGG - Intergenic
1015813310 6:137182771-137182793 CCTCTCTTCTGGATGCTCCAGGG + Intergenic
1015820698 6:137257473-137257495 GTTCCCTTCTGGAGGCCGTACGG + Intergenic
1017069223 6:150559362-150559384 TCTGCCTTCTGGAGGATGCAGGG - Intergenic
1017138139 6:151166087-151166109 CCTTCATTCTGGAAGCTGGATGG - Intergenic
1017533571 6:155322304-155322326 CTTCCTTTCTGGAGGCTCTAGGG - Intergenic
1017655172 6:156620660-156620682 ATTCCCTTCTGGAGGCTCTAGGG - Intergenic
1018209786 6:161469711-161469733 CATTCCTTCTGGAGGCTGTGGGG - Intronic
1018212830 6:161498623-161498645 CCTTCCTTCAGGAAGCAGGATGG - Intronic
1018508223 6:164494296-164494318 TGTTCCTTCTGGAGGCTGCAGGG - Intergenic
1019586192 7:1805161-1805183 TCTCCGTCCTGGAGGCTGGAAGG - Intergenic
1019660052 7:2219250-2219272 CCTCTCTCCTGGTGGCTGGGTGG - Intronic
1022067937 7:26879972-26879994 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1022472075 7:30688281-30688303 TCACCATTCTGGAGGCTGGTAGG - Intronic
1022850348 7:34255461-34255483 TCACAATTCTGGAGGCTGGAAGG - Intergenic
1024236200 7:47401009-47401031 CCTCCCCTCTGGACTCTGGCTGG + Intronic
1024236593 7:47403256-47403278 CCTCCCTTCTGGTATGTGGAGGG - Intronic
1024244691 7:47460367-47460389 CCTCAGTCCTGGAGGCTGGAAGG - Intronic
1024907082 7:54397929-54397951 CCTTCTTTCTGGAGGCTCCAGGG + Intergenic
1026539234 7:71265967-71265989 CCTTCCTTCTGGAAGCTCCAAGG + Intronic
1028090637 7:86696442-86696464 CCTCTTTTTTGGAGGCTGTAAGG - Intronic
1028146446 7:87325162-87325184 CCTCTCTTCTGGATGCTTCAGGG + Intergenic
1029193686 7:98789470-98789492 TCACCATTCTAGAGGCTGGAAGG + Intergenic
1029425130 7:100489924-100489946 CCTCCCTTCCCGGGGCTGCAGGG + Intronic
1031137471 7:117900774-117900796 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1032075558 7:128834156-128834178 ACTGCTTTCAGGAGGCTGGAAGG - Intronic
1033305937 7:140225758-140225780 TCACAGTTCTGGAGGCTGGACGG + Intergenic
1033414225 7:141148080-141148102 TGTCCCTTCTGGAGGCTCTAGGG + Intronic
1033491987 7:141853222-141853244 CTACCATTCTGGAGTCTGGAGGG + Intergenic
1033814672 7:145057429-145057451 CATCCCTTCTGGAGGCTCTGGGG + Intergenic
1034293051 7:149947537-149947559 CCTGCCTTCTGGCTGCTGGATGG - Intergenic
1034410279 7:150937600-150937622 CCGTCCTGCTGCAGGCTGGATGG - Intergenic
1034570818 7:151954961-151954983 TCTCCTTTCTGCAGGCTCGATGG - Intergenic
1034813022 7:154149336-154149358 CCTGCCTTCTGGCTGCTGGATGG + Intronic
1034975020 7:155443217-155443239 CTTGCAGTCTGGAGGCTGGAAGG - Intergenic
1035877892 8:3211757-3211779 CCTCCCTTCTGGACGAGGCATGG - Intronic
1036388946 8:8307784-8307806 TCTCCCTCCAGGATGCTGGAGGG + Intergenic
1037387369 8:18357855-18357877 CCACCCTGCTGGAGGCTGCAGGG + Intergenic
1037420667 8:18698577-18698599 TATTCCTTCTGGAGGCTCGAGGG - Intronic
1037565314 8:20112933-20112955 CCTACATTCTGGAGGCTGGAAGG - Intergenic
1037654590 8:20872237-20872259 TCTCCCTGCTGGAAGCTGGGTGG - Intergenic
1037669427 8:21001591-21001613 CCACAGTTCTAGAGGCTGGAAGG - Intergenic
1037814652 8:22105610-22105632 CCTCCTTTCTGGGCCCTGGAGGG - Intergenic
1037920284 8:22801012-22801034 CTGCCCTTGGGGAGGCTGGATGG - Intronic
1038228833 8:25682053-25682075 GCTCCCTCCTGGAACCTGGAGGG + Intergenic
1038229092 8:25684169-25684191 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
1038438945 8:27558439-27558461 TCACAGTTCTGGAGGCTGGAAGG + Intergenic
1039101472 8:33946538-33946560 ATTCCCTTCTGGAGGCTCCAGGG + Intergenic
1041395698 8:57388860-57388882 TCTCCCTTTTGGGGGCTGGATGG - Intergenic
1041731950 8:61071317-61071339 GGTGCCTTCTGGAGGCTGTAGGG + Intronic
1042004703 8:64168517-64168539 CCTCCCTGCTGCAGCCTGCATGG - Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1042383794 8:68150248-68150270 CCTCCTTTCTGGATGGGGGAGGG + Intronic
1042560238 8:70068474-70068496 CCTACCTTCTGGAAGTTGAAGGG + Exonic
1043812019 8:84752971-84752993 CTACCATTCTGGGGGCTGGAGGG - Intronic
1044237838 8:89852412-89852434 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1044732933 8:95246430-95246452 CCTCCCTTCAGTAGGGTGGCTGG + Exonic
1044835267 8:96289259-96289281 TCTCCTTTCCGGAGGATGGAAGG + Intronic
1044879408 8:96707800-96707822 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1045310269 8:100994969-100994991 CCTCCCTTCTGGGGCCTTGGGGG - Intergenic
1046145221 8:110149683-110149705 GGAGCCTTCTGGAGGCTGGAAGG - Intergenic
1046692249 8:117298956-117298978 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1047295874 8:123570151-123570173 GGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1047356306 8:124125461-124125483 CCTTCCCTCTGGAGGCTTTAGGG + Intergenic
1047407166 8:124595397-124595419 CATTCCTTCTGGAGGCTGCAGGG + Intronic
1047732051 8:127736127-127736149 CTGCCCTTCTCGAGGCAGGAGGG - Exonic
1047759116 8:127940974-127940996 CTTCCATTCTGGAGACTGCAGGG + Intergenic
1048217881 8:132513386-132513408 CATTTCTTCTGGAGGCTGTAGGG + Intergenic
1048440103 8:134453444-134453466 CATCCCTTCTGGAGGCTCCAGGG + Intergenic
1048555796 8:135474886-135474908 GCTCCTTTCTGGAGGCTTCAGGG + Intronic
1048737640 8:137519421-137519443 GATCCATTCTGGAGGCAGGAAGG + Intergenic
1048985638 8:139733355-139733377 TCTCAGTTCTGGAGGCAGGAAGG - Intronic
1049260998 8:141639234-141639256 CCTCCCGGGTGGAGGCTGCAAGG - Intergenic
1051510644 9:17874283-17874305 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1052060781 9:23958677-23958699 CTTCCTTTCTGGAGGCTCTAGGG - Intergenic
1052278143 9:26702078-26702100 CATTCCTTCTGGAGGCTCAAAGG - Intergenic
1053214733 9:36260987-36261009 CCTTCCTACTGGAGGCTGCCAGG + Intronic
1053526665 9:38837162-38837184 TCTCACGTTTGGAGGCTGGAGGG + Intergenic
1054852834 9:69866298-69866320 TCTGCCTTCTGTAAGCTGGAGGG + Intronic
1055344302 9:75318222-75318244 TCACTCTTCTGGAAGCTGGATGG + Intergenic
1055728718 9:79258833-79258855 TCACATTTCTGGAGGCTGGAAGG - Intergenic
1056069527 9:82971714-82971736 CCTTCCTTCTAGAGGCTCTAGGG - Intergenic
1056623490 9:88234907-88234929 CCTCCGTTCTGCTGCCTGGAGGG - Intergenic
1056720079 9:89063957-89063979 TCACAGTTCTGGAGGCTGGAAGG + Intronic
1057031970 9:91782975-91782997 TCTCAGTTCAGGAGGCTGGAAGG + Intronic
1057072928 9:92115581-92115603 CCTCCCTGCTGGATTCAGGATGG + Intergenic
1057544890 9:96011152-96011174 CCACAGTTCTGGAGGCTGGATGG + Intronic
1057664580 9:97034905-97034927 CCTCCCTTATGGAGGGTGGTAGG - Intronic
1057696532 9:97326675-97326697 CCTGCCTTCTGGAGTCTGGTTGG - Intronic
1057860595 9:98637735-98637757 CTTTCCTTCTGGAGGCTTTAGGG - Intronic
1057951998 9:99376645-99376667 CCCTCCCTCTGGAGGCTGTAGGG - Intergenic
1058339944 9:103882527-103882549 GTTCCTTTCTGGAAGCTGGAGGG + Intergenic
1058401587 9:104625483-104625505 CTACCATTCTGGAGTCTGGAGGG - Intergenic
1058653989 9:107203213-107203235 CCTGCTTTCTGGAGGCTCTAGGG - Intergenic
1060997904 9:127885475-127885497 CTGCTCTTCTGGAGCCTGGAAGG - Exonic
1061073457 9:128326357-128326379 CCTCCCTGCCTGGGGCTGGAGGG - Intronic
1061177872 9:129008416-129008438 CCTCCTTAGTGGAGCCTGGAGGG + Exonic
1061425691 9:130496911-130496933 CCTCCCTCCTGGAGGCTGGTTGG + Intronic
1061796469 9:133088380-133088402 CCTCCCACCTGTAGGCTGGAGGG - Intergenic
1062346951 9:136119283-136119305 CCGCCCTCCTGGAGCCTGGGGGG - Intergenic
1062406471 9:136399231-136399253 TCTCCCTGCTGGAGGCTGACTGG + Intergenic
1062414114 9:136439357-136439379 CCTCCCTTCCGGCGGCTGCGGGG + Exonic
1062442556 9:136577437-136577459 CCTTCTTCCTGGAGCCTGGATGG - Intergenic
1062678075 9:137760030-137760052 CCTGCCTTATTGAGGCTGAATGG + Intronic
1185536840 X:869227-869249 TCTTCCCTCTGGAGGCTGTAGGG + Intergenic
1185622012 X:1455771-1455793 GCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1186292798 X:8118810-8118832 CCTTCCTTCTAGAGGCTCTAGGG - Intergenic
1186331830 X:8542615-8542637 ACTCCTTTCTGGAGGCTCCAGGG + Intronic
1186577154 X:10778781-10778803 CCTTCCTTCTGGATGCTCTAGGG - Intronic
1186587225 X:10888259-10888281 CCTCCCAACTGGAGACTGCAGGG - Intergenic
1187576866 X:20566110-20566132 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1188049217 X:25464312-25464334 TCACAGTTCTGGAGGCTGGAAGG - Intergenic
1188092975 X:25986219-25986241 ATTTCCTTCTGGAGGCTGTAAGG - Intergenic
1188268938 X:28114522-28114544 TATTCCTTCTGGAGACTGGAGGG - Intergenic
1188355271 X:29183006-29183028 CTTTCCTTCTGGAGGCTCTAAGG - Intronic
1188543272 X:31272785-31272807 CCTCCCTTATGGAGTCAAGAAGG - Intronic
1189217164 X:39336132-39336154 CCTCTTTTCTGAAGGCTGAAAGG - Intergenic
1189632643 X:42971520-42971542 CCTCTCTTCTGGATGCTTCAGGG + Intergenic
1189830852 X:44971818-44971840 CCTCCCCTGTGCAGTCTGGATGG + Intronic
1190118623 X:47642185-47642207 CGTTCCTTCTGGAGGCTCTAGGG - Intronic
1190517007 X:51234255-51234277 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1191189657 X:57653055-57653077 CCTTCCTTCTGGATGCTCCAGGG - Intergenic
1193284960 X:79701521-79701543 TCTCAGTTCTGGAGGCTGAAAGG - Intergenic
1193332027 X:80245503-80245525 GCCCCCTTCTGGAAGCTGTAGGG - Intergenic
1193529814 X:82642991-82643013 CCACCTTTCTGGGGTCTGGATGG + Intergenic
1195216837 X:102711961-102711983 CCTCCTTTCTGGAAGCTGATGGG - Intergenic
1196636206 X:118005719-118005741 GTTCCTTTCTGGAGGCTGTAGGG - Intronic
1196898514 X:120361214-120361236 CCACCCTACTGGAGCCTGGGTGG - Intergenic
1198145491 X:133852323-133852345 CCTCCTTTCTGGAGGCAGCCTGG - Intronic
1199361990 X:146931629-146931651 CCTCCTTTCTGGTGGCTCTAAGG + Intergenic
1199510026 X:148611509-148611531 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1199850766 X:151723669-151723691 CCTCAGCTCTGGAGGCTGAACGG + Intergenic
1200021848 X:153218485-153218507 TAGCCTTTCTGGAGGCTGGAAGG + Intergenic
1201430784 Y:13900003-13900025 ACTCCTTTCTGGAGGCTCCAGGG - Intergenic