ID: 1136147580

View in Genome Browser
Species Human (GRCh38)
Location 16:28324435-28324457
Sequence GAGGAATCCTGGTACACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136147580_1136147592 17 Left 1136147580 16:28324435-28324457 CCTTTTGTGTACCAGGATTCCTC No data
Right 1136147592 16:28324475-28324497 AGCACTGAGCAGGACAGACAGGG No data
1136147580_1136147587 -10 Left 1136147580 16:28324435-28324457 CCTTTTGTGTACCAGGATTCCTC No data
Right 1136147587 16:28324448-28324470 AGGATTCCTCCTAGGGGCTGGGG No data
1136147580_1136147590 7 Left 1136147580 16:28324435-28324457 CCTTTTGTGTACCAGGATTCCTC No data
Right 1136147590 16:28324465-28324487 CTGGGGACACAGCACTGAGCAGG No data
1136147580_1136147591 16 Left 1136147580 16:28324435-28324457 CCTTTTGTGTACCAGGATTCCTC No data
Right 1136147591 16:28324474-28324496 CAGCACTGAGCAGGACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136147580 Original CRISPR GAGGAATCCTGGTACACAAA AGG (reversed) Intergenic
No off target data available for this crispr