ID: 1136148969

View in Genome Browser
Species Human (GRCh38)
Location 16:28333758-28333780
Sequence GGAGTCTCCTAGTCTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136148969_1136148971 -10 Left 1136148969 16:28333758-28333780 CCAGTTCCAGACTAGGAGACTCC No data
Right 1136148971 16:28333771-28333793 AGGAGACTCCAAAGAGACACTGG No data
1136148969_1136148975 19 Left 1136148969 16:28333758-28333780 CCAGTTCCAGACTAGGAGACTCC No data
Right 1136148975 16:28333800-28333822 CCACAATGTGCAAACCTGATTGG No data
1136148969_1136148976 20 Left 1136148969 16:28333758-28333780 CCAGTTCCAGACTAGGAGACTCC No data
Right 1136148976 16:28333801-28333823 CACAATGTGCAAACCTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136148969 Original CRISPR GGAGTCTCCTAGTCTGGAAC TGG (reversed) Intergenic
No off target data available for this crispr