ID: 1136162790

View in Genome Browser
Species Human (GRCh38)
Location 16:28431662-28431684
Sequence CAATTTATGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136162790_1136162801 21 Left 1136162790 16:28431662-28431684 CCTTCCTCCTCCTCCATAAATTG No data
Right 1136162801 16:28431706-28431728 GGACCAAAACATATCTGCACTGG No data
1136162790_1136162796 -2 Left 1136162790 16:28431662-28431684 CCTTCCTCCTCCTCCATAAATTG No data
Right 1136162796 16:28431683-28431705 TGGACCAAAACATATCCTGCTGG No data
1136162790_1136162797 -1 Left 1136162790 16:28431662-28431684 CCTTCCTCCTCCTCCATAAATTG No data
Right 1136162797 16:28431684-28431706 GGACCAAAACATATCCTGCTGGG No data
1136162790_1136162798 0 Left 1136162790 16:28431662-28431684 CCTTCCTCCTCCTCCATAAATTG No data
Right 1136162798 16:28431685-28431707 GACCAAAACATATCCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136162790 Original CRISPR CAATTTATGGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr