ID: 1136163259

View in Genome Browser
Species Human (GRCh38)
Location 16:28435363-28435385
Sequence GTGGATGGAGAGGCACGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136163244_1136163259 30 Left 1136163244 16:28435310-28435332 CCCTTTCTGGGCTGGCCAAGGCC 0: 679
1: 658
2: 365
3: 317
4: 480
Right 1136163259 16:28435363-28435385 GTGGATGGAGAGGCACGAGTGGG No data
1136163247_1136163259 15 Left 1136163247 16:28435325-28435347 CCAAGGCCGGAGCCAGCTGCCTT No data
Right 1136163259 16:28435363-28435385 GTGGATGGAGAGGCACGAGTGGG No data
1136163254_1136163259 -4 Left 1136163254 16:28435344-28435366 CCTTAGCTTGCGGGGAGGTGTGG 0: 7
1: 232
2: 1077
3: 709
4: 401
Right 1136163259 16:28435363-28435385 GTGGATGGAGAGGCACGAGTGGG No data
1136163252_1136163259 3 Left 1136163252 16:28435337-28435359 CCAGCTGCCTTAGCTTGCGGGGA No data
Right 1136163259 16:28435363-28435385 GTGGATGGAGAGGCACGAGTGGG No data
1136163245_1136163259 29 Left 1136163245 16:28435311-28435333 CCTTTCTGGGCTGGCCAAGGCCG 0: 411
1: 773
2: 350
3: 290
4: 374
Right 1136163259 16:28435363-28435385 GTGGATGGAGAGGCACGAGTGGG No data
1136163248_1136163259 9 Left 1136163248 16:28435331-28435353 CCGGAGCCAGCTGCCTTAGCTTG No data
Right 1136163259 16:28435363-28435385 GTGGATGGAGAGGCACGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136163259 Original CRISPR GTGGATGGAGAGGCACGAGT GGG Intergenic
No off target data available for this crispr