ID: 1136165012

View in Genome Browser
Species Human (GRCh38)
Location 16:28447970-28447992
Sequence CTGTGGAAAGTGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136165012_1136165021 26 Left 1136165012 16:28447970-28447992 CCTTCCTCTCTCACTTTCCACAG No data
Right 1136165021 16:28448019-28448041 GGACTGTACTGCCACCATCTCGG 0: 22
1: 170
2: 905
3: 703
4: 7990
1136165012_1136165015 1 Left 1136165012 16:28447970-28447992 CCTTCCTCTCTCACTTTCCACAG No data
Right 1136165015 16:28447994-28448016 CTCCCTCTGATGCCGAGCCGAGG 0: 65
1: 133
2: 87
3: 16
4: 214
1136165012_1136165018 5 Left 1136165012 16:28447970-28447992 CCTTCCTCTCTCACTTTCCACAG No data
Right 1136165018 16:28447998-28448020 CTCTGATGCCGAGCCGAGGCTGG 0: 67
1: 556
2: 574
3: 370
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136165012 Original CRISPR CTGTGGAAAGTGAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr