ID: 1136171461

View in Genome Browser
Species Human (GRCh38)
Location 16:28492194-28492216
Sequence GTTTAAAACCTGCGGTTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136171461_1136171469 24 Left 1136171461 16:28492194-28492216 CCCTGGAACCGCAGGTTTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1136171461_1136171468 -10 Left 1136171461 16:28492194-28492216 CCCTGGAACCGCAGGTTTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1136171468 16:28492207-28492229 GGTTTTAAACTGGAGCGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136171461 Original CRISPR GTTTAAAACCTGCGGTTCCA GGG (reversed) Exonic
900856185 1:5186436-5186458 GGATAAAACCTTCAGTTCCAGGG - Intergenic
901963641 1:12847995-12848017 GTTTCACACCTGCGTTTCCTCGG + Exonic
901984254 1:13061597-13061619 GTTTCACACCTGCGTTTCCTCGG - Exonic
901991286 1:13116106-13116128 GTTTCACACCTGCGTTTCCTCGG + Intergenic
901997557 1:13165173-13165195 GTTTCACACCTGCGTTTCCTCGG + Exonic
902262850 1:15239720-15239742 GTTTAGGACCTCCTGTTCCAAGG + Intergenic
907496055 1:54845523-54845545 GTGTAAAACATGCGTTTCAAAGG - Intergenic
908372863 1:63501248-63501270 GATAAAAACCTGTGTTTCCATGG + Intronic
919249094 1:195030123-195030145 CTTTAAATCCTGCCATTCCATGG + Intergenic
920914377 1:210248209-210248231 GTATGAAACCTGGGGTCCCAGGG + Intergenic
1063113651 10:3057670-3057692 GTTCAAACCCTGCTGTTCAAGGG + Intergenic
1069209590 10:65739273-65739295 GTTTCTAACCTGCTGTACCAGGG - Intergenic
1070296671 10:75167553-75167575 GTTAAACACCTGTGATTCCAGGG - Intronic
1074992897 10:118726899-118726921 GTTTAAAACATGGGGATCCAGGG - Intronic
1081262243 11:40974883-40974905 GTGTAAATCCTGGAGTTCCAAGG - Intronic
1081557926 11:44184241-44184263 GGTGAAAACATGCTGTTCCAGGG + Intronic
1082750474 11:57009725-57009747 CTTGAGAACCTGAGGTTCCAGGG - Intergenic
1083330630 11:61896807-61896829 GTCTAAGACCTGGGCTTCCATGG + Intergenic
1085797026 11:79551076-79551098 GTTTAAAACCTGATATTTCAAGG + Intergenic
1090619275 11:128547268-128547290 GGTTAAAAACTACTGTTCCAAGG - Intronic
1092937848 12:13380417-13380439 GTTTAAAAGATGGGATTCCAAGG - Intronic
1100605998 12:96152573-96152595 GTTAAAAACATGTGGCTCCAAGG - Intergenic
1102476489 12:113191895-113191917 CTTTAATACCTGGGGTTCCCTGG - Exonic
1103731158 12:123028747-123028769 TTTTCTAACCTGCGGTTCCTGGG - Intronic
1109911143 13:68912316-68912338 TTTAAAAACCTGCAGTACCAAGG + Intergenic
1111359813 13:87161474-87161496 GGTAAAAACTTACGGTTCCAAGG + Intergenic
1114653615 14:24302653-24302675 GTTTACAGCTTGAGGTTCCATGG + Intronic
1125391923 15:39201814-39201836 GCTTAAAACTTGGGTTTCCATGG - Intergenic
1126954186 15:53914156-53914178 GTATAAAACCTGTGTGTCCAGGG + Intergenic
1132781954 16:1632025-1632047 GATTAAAACCTAAGGTTCCAGGG + Intronic
1136171461 16:28492194-28492216 GTTTAAAACCTGCGGTTCCAGGG - Exonic
1136564253 16:31060753-31060775 GTTTCAAATCTGTGGATCCAGGG + Intergenic
1141296927 16:82778473-82778495 GTTTAAAACCTTCTATTCCAGGG - Intronic
1142678807 17:1533263-1533285 GATTAAGAGCTGTGGTTCCAGGG + Intronic
1150324154 17:64242591-64242613 GTTTCAGACCTGTGGTGCCAGGG + Intronic
1151590220 17:75038573-75038595 GTTTCAAACCCCTGGTTCCAAGG - Intronic
1154801561 18:19126499-19126521 GTTTCAAACCTGCTCTACCAAGG - Intergenic
1158827576 18:61240717-61240739 GTTTAAAACATCAGCTTCCAGGG + Intergenic
1161164557 19:2779246-2779268 GTTTCAGAACTGCGGGTCCACGG + Intronic
1167500195 19:49842000-49842022 GATTAAACCCTGCTGTTCTAGGG - Intergenic
926760599 2:16275480-16275502 CTTAAAAACCTTCTGTTCCAGGG - Intergenic
931941276 2:67254596-67254618 GTTCACAACCTGCAGTGCCAGGG + Intergenic
932380390 2:71276721-71276743 GTCCAAAACCTGCGGTGCCCCGG - Intronic
935916627 2:107959384-107959406 AATTAAAACCTGAGGTTACATGG + Intergenic
939049931 2:137295815-137295837 TTTTAAATGCTGAGGTTCCATGG + Intronic
1169893601 20:10479001-10479023 GCCTAAAACCTGGGATTCCAGGG + Intronic
1170331194 20:15212799-15212821 GTTTTCAACCTGTGGTTCCTAGG + Intronic
1178142993 21:29705062-29705084 GTTCACAACCTGTGGTTCCAGGG + Intronic
1181879357 22:25965463-25965485 GTTTAACAACTGCCTTTCCAGGG + Intronic
1185050252 22:48550651-48550673 GGTTGGAACCTGCGGCTCCAAGG + Intronic
959733649 3:109632459-109632481 GTTTAACATCTGTGGTTCAAAGG - Intergenic
960024169 3:112989484-112989506 TTTCCAAACCTGGGGTTCCAAGG + Intergenic
961986210 3:131137834-131137856 TTTTAAAACCTGGTGTTCCTGGG - Intronic
963882355 3:150542930-150542952 GTTAAAAACCTGCTGGCCCAAGG + Exonic
964245940 3:154653630-154653652 TTGTAAAACTTGCGATTCCATGG + Intergenic
965143224 3:164865607-164865629 TTTTAAAAACTGCCATTCCAGGG + Intergenic
973560992 4:52135222-52135244 TTTTAAAACTTGTGGTTCAAAGG + Intergenic
973810433 4:54564671-54564693 GTTTGAAAACTGCAGTTCTATGG + Intergenic
976765438 4:88592984-88593006 ATTTAAATTCTGGGGTTCCAGGG + Intronic
982907421 4:161092423-161092445 GTTGAATACCTGTTGTTCCAGGG - Intergenic
983689717 4:170453392-170453414 GTTTAGAAGTTGAGGTTCCAAGG - Intergenic
983911802 4:173248047-173248069 GATTCAAACCTGTGGTACCATGG + Exonic
984794829 4:183649830-183649852 GTTGAAGATCTGAGGTTCCAAGG + Intronic
987356723 5:17069886-17069908 GTTTAAAAGCTGCCGCTCCTTGG + Intronic
993887488 5:93432945-93432967 GTATAAAACCTGTGGTTTCTTGG - Intergenic
996862435 5:128082734-128082756 TTTTAAAAGCTGATGTTCCAAGG - Intergenic
997281954 5:132654988-132655010 GTTCAGAACCTGCTGTTCAAGGG - Intergenic
1001465678 5:171963493-171963515 GTTTAAGACCTGTTGTTCTACGG - Intronic
1006694243 6:35917672-35917694 GTTTAAGATCTGCAGTACCAGGG + Intronic
1008767234 6:54933723-54933745 ATGTTAAACCTGCAGTTCCATGG - Intronic
1012313639 6:97758435-97758457 GTTTAAAACCTACGGATCTTAGG + Intergenic
1013563448 6:111330221-111330243 CATTCAAACCTGCAGTTCCAGGG + Intronic
1013731111 6:113168672-113168694 GTTCCAAACCTGTGTTTCCATGG - Intergenic
1014783838 6:125595439-125595461 TTTTAAAACCTACATTTCCATGG + Intergenic
1018199614 6:161383061-161383083 ATCTAAAGCCTTCGGTTCCAAGG + Intronic
1020004294 7:4774156-4774178 GTCTTCAACCTGCGGCTCCAGGG + Intronic
1021119838 7:16786762-16786784 GTTAAAAACCAGCTTTTCCAGGG + Intergenic
1028621736 7:92834691-92834713 GGTTAAATCCTGCGCCTCCAGGG + Intronic
1030246430 7:107388669-107388691 GTATAAAACCTGCAGTTTCATGG + Intronic
1030935066 7:115575497-115575519 ATTTAAAACCTGAGGTTCTGAGG + Intergenic
1031303222 7:120090125-120090147 GCTGACACCCTGCGGTTCCATGG + Intergenic
1036432674 8:8704513-8704535 CTTTAAAACCTGCCGTTCAGAGG + Intergenic
1038118967 8:24590462-24590484 GTTCAAAGCCTGCAGTTACATGG + Intergenic
1039728919 8:40253321-40253343 GCTTAAAAGCTGCAGTACCAAGG - Intergenic
1043078096 8:75727760-75727782 TTTTAAAACCTGGGTTTACAGGG + Intergenic
1047930640 8:129725297-129725319 GTTCATTACCTGAGGTTCCAGGG - Intergenic
1050651964 9:7786059-7786081 GTGTATAACCTGCGTATCCAAGG - Intergenic
1051511513 9:17883685-17883707 TTTTAAAACCTGTGCTTCAAAGG - Intergenic
1053954934 9:43453034-43453056 GTTTCAAACCTGCTGTACGAAGG - Intergenic
1059884911 9:118735240-118735262 GTTTAGAACCTGAGGTTAGAAGG + Intergenic
1188122427 X:26325062-26325084 TTTTATAAACTCCGGTTCCAGGG - Intergenic
1188597564 X:31919943-31919965 CTTGCAAACCTGGGGTTCCATGG + Intronic
1199544810 X:148996685-148996707 GCTTAAAACCTAGGCTTCCAGGG - Exonic
1202327926 Y:23712038-23712060 GTTTTAAACCTGTAGTTCTAAGG - Intergenic
1202542844 Y:25958014-25958036 GTTTTAAACCTGTAGTTCTAAGG + Intergenic