ID: 1136171462

View in Genome Browser
Species Human (GRCh38)
Location 16:28492195-28492217
Sequence AGTTTAAAACCTGCGGTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136171462_1136171469 23 Left 1136171462 16:28492195-28492217 CCTGGAACCGCAGGTTTTAAACT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136171462 Original CRISPR AGTTTAAAACCTGCGGTTCC AGG (reversed) Exonic
902524382 1:17046231-17046253 AGTTTACAAAATGGGGTTCCCGG - Intronic
914811364 1:151030784-151030806 ACTTTAAAAACTGCAGTTCTTGG - Intronic
922006656 1:221537741-221537763 AGTTGGAAAACTGTGGTTCCAGG - Intergenic
1064728449 10:18304759-18304781 AGTTTAAAACTTACGGTTTGTGG + Intronic
1066433632 10:35376134-35376156 AGTTTAATAACTGCTGTGCCAGG - Intronic
1066755784 10:38711746-38711768 AGTTTAAAAACTTGTGTTCCTGG - Intergenic
1067955807 10:50789253-50789275 AGTTTAAAAACTGTGGTTATAGG + Intronic
1070296672 10:75167554-75167576 AGTTAAACACCTGTGATTCCAGG - Intronic
1071117690 10:82242335-82242357 AGTTAGAAACCTGCAGTTTCAGG + Intronic
1071713697 10:88074395-88074417 AGATAAAAACCTGAGGTTCAAGG + Intergenic
1074992898 10:118726900-118726922 GGTTTAAAACATGGGGATCCAGG - Intronic
1075189984 10:120298284-120298306 AAAATAAAACCTGGGGTTCCAGG + Intergenic
1077372860 11:2191765-2191787 AGTTAAAAAACTGTGGTTTCAGG - Intergenic
1081868520 11:46372635-46372657 AGTGCACAACCTGCGGATCCTGG + Exonic
1084217133 11:67654207-67654229 AGCTTACAACCTTCGCTTCCTGG - Intergenic
1084218655 11:67664947-67664969 AGTTTAGAACCTGGGGATCATGG + Intronic
1087064117 11:94011458-94011480 AGTCTAAAAACTGGGGATCCAGG + Intergenic
1088352429 11:108905162-108905184 AGTTCTTAACCTGGGGTTCCTGG - Intronic
1097007505 12:55929694-55929716 CGTTTAATGCCTACGGTTCCAGG - Intronic
1097062326 12:56294730-56294752 AGTTTAATACTTGTGATTCCTGG - Intronic
1101061503 12:100977388-100977410 AATTTAAAACCTAAGGGTCCAGG + Intronic
1102942478 12:116955814-116955836 AGTATAAAACCTGAGGTGCAGGG + Intronic
1102993663 12:117332391-117332413 AGTTTAAAAGCTCAGGCTCCAGG - Intronic
1103731159 12:123028748-123028770 TTTTTCTAACCTGCGGTTCCTGG - Intronic
1107462167 13:40614804-40614826 AGTTTAAATCCAGCGGGCCCTGG - Intronic
1107787277 13:43969452-43969474 AGTGCACAACCTGCGGATCCTGG + Intergenic
1107921019 13:45207729-45207751 AGTTTAAAAACTTTGATTCCAGG - Intronic
1114706709 14:24734699-24734721 GGTTCAAAACCTGGGGTCCCTGG + Intergenic
1114911536 14:27205114-27205136 ACTTTCAAACCTGCAGTTCTTGG + Intergenic
1126999747 15:54488227-54488249 AGTTTAGAACCAACGTTTCCTGG + Intronic
1131550720 15:93354552-93354574 AATTTAAAATCTGCATTTCCTGG + Intergenic
1132781953 16:1632024-1632046 TGATTAAAACCTAAGGTTCCAGG + Intronic
1136171462 16:28492195-28492217 AGTTTAAAACCTGCGGTTCCAGG - Exonic
1136564252 16:31060752-31060774 AGTTTCAAATCTGTGGATCCAGG + Intergenic
1136726894 16:32365093-32365115 AGTTTAAAAACTTGTGTTCCTGG + Intergenic
1141296928 16:82778474-82778496 AGTTTAAAACCTTCTATTCCAGG - Intronic
1141380286 16:83570033-83570055 AGTTTAAAACCACTGGCTCCTGG - Intronic
1202999540 16_KI270728v1_random:152666-152688 AGTTTAAAAACTTGTGTTCCTGG - Intergenic
1203131138 16_KI270728v1_random:1689065-1689087 AGTTTAAAAACTTGTGTTCCTGG - Intergenic
1150324153 17:64242590-64242612 AGTTTCAGACCTGTGGTGCCAGG + Intronic
1155618014 18:27743749-27743771 AGTTTAAAAGTTGCAGTTTCCGG - Intergenic
1159984961 18:74831018-74831040 AGTTTATAACTTTCTGTTCCTGG + Intronic
1161612117 19:5248899-5248921 AGTTTAGCACCTGCTGTGCCAGG - Intronic
1164795221 19:31021220-31021242 TGTTTAAAATCTTTGGTTCCTGG + Intergenic
925314638 2:2911924-2911946 AGTTCAAAAGCTGCCCTTCCTGG + Intergenic
927335869 2:21923506-21923528 AATTTAAAGCCTGCATTTCCAGG - Intergenic
927673680 2:25089605-25089627 GGTTTAAACCCTGGGCTTCCAGG + Intronic
928647441 2:33369483-33369505 AGTTTTCAACATGCGTTTCCTGG - Intronic
928986918 2:37191052-37191074 ATTTTAAAAGCTGGGGTTCCTGG + Intronic
934319084 2:91955976-91955998 AGTTTAAAAACTTGTGTTCCTGG - Intergenic
939292101 2:140209385-140209407 AGTTTAAAACCTGGGTTTTCTGG - Intergenic
944353594 2:198758751-198758773 AGTTTAAAACCTGGTCTTCCAGG + Intergenic
948284782 2:236775112-236775134 ATATTCAAACGTGCGGTTCCAGG - Intergenic
1172922458 20:38496691-38496713 AGTTTTAAAACTGTTGTTCCGGG + Intronic
1173989220 20:47287402-47287424 AGGCTAAAACCAGAGGTTCCTGG + Intronic
1178142992 21:29705061-29705083 AGTTCACAACCTGTGGTTCCAGG + Intronic
1180307264 22:11139643-11139665 AGTTTAAAAACTTGTGTTCCTGG - Intergenic
1180545784 22:16501827-16501849 AGTTTAAAAACTTGTGTTCCTGG - Intergenic
1181745167 22:24951089-24951111 AGTTTCAACCCAGCCGTTCCTGG + Intergenic
1182990672 22:34764493-34764515 AATTTAAAACCTGAGATGCCTGG + Intergenic
953200731 3:40776613-40776635 ATTTTTAACCCTGGGGTTCCTGG - Intergenic
955571520 3:60312005-60312027 AGTTTAAAACATGCTGGTCACGG - Intronic
961986211 3:131137835-131137857 TTTTTAAAACCTGGTGTTCCTGG - Intronic
965119235 3:164529878-164529900 AGTTTACATTCTGAGGTTCCAGG + Intergenic
968580893 4:1394456-1394478 AATTTAAAAACTGGGTTTCCTGG - Exonic
971132353 4:23826877-23826899 ACTTTAAAACCTGTGCTGCCGGG + Intronic
976227440 4:82806755-82806777 AGTCTAAAACCTGGGTTTGCAGG + Intergenic
977951444 4:102975384-102975406 AGTTTAAAAACTTGAGTTCCTGG - Intronic
983188804 4:164732285-164732307 ATTTTAAAAACTTCGTTTCCTGG - Intergenic
993360855 5:86974173-86974195 AGTTTAGAATCTGCTGTTCTGGG - Intergenic
994197257 5:96935163-96935185 AAATCAACACCTGCGGTTCCCGG - Intronic
996564736 5:124867827-124867849 AGGTTAAAAACTGCGAATCCAGG - Intergenic
997281955 5:132654989-132655011 AGTTCAGAACCTGCTGTTCAAGG - Intergenic
997904617 5:137804020-137804042 AGTTTCAAGCCTGCTGTTGCAGG + Intergenic
998606826 5:143643976-143643998 AGTTTAAAACCTGATTTTCTAGG + Intergenic
1012357678 6:98336243-98336265 AGTTTAAAACTTGTGGTTGATGG - Intergenic
1013563447 6:111330220-111330242 ACATTCAAACCTGCAGTTCCAGG + Intronic
1017961089 6:159221413-159221435 AGTTTAATTCCTGCAGTTCTTGG + Intronic
1020004293 7:4774155-4774177 AGTCTTCAACCTGCGGCTCCAGG + Intronic
1021119837 7:16786761-16786783 AGTTAAAAACCAGCTTTTCCAGG + Intergenic
1022637787 7:32153564-32153586 AGTTTTAAACATGCACTTCCTGG + Intronic
1035924717 8:3715363-3715385 AGTCTAAAACCTGAGCCTCCAGG + Intronic
1043078095 8:75727759-75727781 ATTTTAAAACCTGGGTTTACAGG + Intergenic
1047930641 8:129725298-129725320 AGTTCATTACCTGAGGTTCCAGG - Intergenic
1048399381 8:134049833-134049855 AGTTTCAAACCTGAAGTTTCTGG + Intergenic
1051677064 9:19569307-19569329 AGGTAAGAACCTGTGGTTCCAGG - Intronic
1052197641 9:25736865-25736887 ATTTTAAAAACTGAGGTCCCTGG - Intergenic
1058979350 9:110155030-110155052 AGTTAAAAACCTGGGTTTCCTGG + Intronic
1060429884 9:123541852-123541874 AATGAAAAACCTGCGGTTCAGGG + Intronic
1062636253 9:137493102-137493124 AGTTTAAAACGTGTGGCTCTTGG - Intronic
1185879521 X:3728322-3728344 AGTTTAGAAGCTGCTGCTCCTGG - Intergenic
1192618242 X:72650418-72650440 AGTAGAAAACCTGCGATTCAGGG + Exonic
1195758929 X:108225542-108225564 GGTTGCAGACCTGCGGTTCCTGG - Intronic