ID: 1136171464

View in Genome Browser
Species Human (GRCh38)
Location 16:28492202-28492224
Sequence CCGCTCCAGTTTAAAACCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136171464_1136171469 16 Left 1136171464 16:28492202-28492224 CCGCAGGTTTTAAACTGGAGCGG 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136171464 Original CRISPR CCGCTCCAGTTTAAAACCTG CGG (reversed) Exonic
906067882 1:42995212-42995234 CAGGTCAAGTTTAAAACCTCAGG - Intergenic
912038871 1:105359025-105359047 CCTTTCCAGTTTTAAACATGAGG - Intergenic
917178772 1:172269074-172269096 CAACTCCAGTTTAAATCCTTGGG - Intronic
922536847 1:226387334-226387356 CCTCTCCATTTTAAAGGCTGAGG + Intronic
923369443 1:233295624-233295646 CAGCTCCAGCTTCAAACGTGGGG - Exonic
1073513637 10:104058212-104058234 CTCCTCCAGTTTAAAAGCTCAGG - Intronic
1077497692 11:2894339-2894361 CTGCTTCAAATTAAAACCTGGGG - Intronic
1084292226 11:68180802-68180824 CCACTCCATTTAAAAACCAGAGG + Intronic
1090225203 11:125066890-125066912 CATCTCCAGTTGAAAACCAGTGG + Intronic
1090634272 11:128680344-128680366 CTGCTCCTGTTTAAAAACTATGG - Intergenic
1097735647 12:63178274-63178296 CTGCTCCAGTTGACAACATGGGG + Intergenic
1102791200 12:115647272-115647294 CAGTTCAAGTTGAAAACCTGGGG + Intergenic
1115729974 14:36258147-36258169 CCACTCAAGTTCAAAACCTCAGG - Intergenic
1122627276 14:103091037-103091059 CCGCTTCAGTTTTAAACCGCAGG + Intergenic
1128805707 15:70529505-70529527 CCGTTCTAGTCTAAACCCTGAGG - Intergenic
1131507154 15:93029140-93029162 CGGCTCCAGATTCCAACCTGTGG + Intergenic
1135644032 16:24145762-24145784 CCGGGCCAGTTGAAAACCGGAGG + Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1138718733 16:59053772-59053794 CCTCTCCAGTATAAAGGCTGTGG + Intergenic
1148557816 17:48589023-48589045 CCCCTCCAATTTAACACCCGTGG - Intronic
1155050814 18:22146345-22146367 TCACTCCAGTTTAAAACTTTAGG - Intergenic
1158755359 18:60317802-60317824 CCACTCCAGTTTATAACCTTAGG - Intergenic
1163870312 19:19815770-19815792 GAGCTACTGTTTAAAACCTGGGG + Intronic
928336096 2:30399855-30399877 CCCACCCAGTTTTAAACCTGGGG - Intergenic
932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG + Intergenic
932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG + Intergenic
948297145 2:236869301-236869323 TCACTCCAGTTTCAAACTTGAGG - Intergenic
1170022547 20:11852261-11852283 CACCTCCAGTTTCCAACCTGTGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1178128981 21:29548030-29548052 ACCCTCCAGTTGAAAAACTGGGG + Intronic
1183666616 22:39249875-39249897 CCTCTCCAGGTGAAGACCTGTGG - Intergenic
953151119 3:40325980-40326002 GGGCTTCAGGTTAAAACCTGAGG - Intergenic
956588205 3:70885922-70885944 CGGCACCAGTTTACAACCTTTGG - Intergenic
957896564 3:86427520-86427542 CCGCTCCCATTTAAAACCTGAGG + Intergenic
968684072 4:1944542-1944564 GCTCTCCAGTGTAAAACTTGAGG + Intronic
970061122 4:12035714-12035736 CAGCTCCAGTTTAGAACCACTGG - Intergenic
982127311 4:152195634-152195656 CCACCCCAGTTTCCAACCTGCGG + Intergenic
1003583706 6:7366557-7366579 CAGCTCCTGATAAAAACCTGGGG + Intronic
1008198657 6:48558555-48558577 CAGCTCAAGTTCAAAAGCTGGGG + Intergenic
1017275769 6:152566157-152566179 CCCCTCCAGTGTTGAACCTGGGG + Intronic
1026203584 7:68236175-68236197 CAGCTCTAGTTTAAAAACTGTGG + Intergenic
1038943798 8:32335093-32335115 CCACTTCAGTTTAAATCCTATGG - Intronic
1040296233 8:46150541-46150563 CCGCCCTACTTTAAAACCTGGGG + Intergenic
1048356426 8:133657489-133657511 GGGCTCCAATTTAAAACTTGGGG + Intergenic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1189835196 X:45013232-45013254 CCTCTCAATCTTAAAACCTGGGG - Intronic