ID: 1136171469

View in Genome Browser
Species Human (GRCh38)
Location 16:28492241-28492263
Sequence GAGCCGTGACCTTAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136171464_1136171469 16 Left 1136171464 16:28492202-28492224 CCGCAGGTTTTAAACTGGAGCGG 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1136171461_1136171469 24 Left 1136171461 16:28492194-28492216 CCCTGGAACCGCAGGTTTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1136171462_1136171469 23 Left 1136171462 16:28492195-28492217 CCTGGAACCGCAGGTTTTAAACT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136171469 Original CRISPR GAGCCGTGACCTTAGATCAG TGG Intronic
900483027 1:2908548-2908570 GAGGCGTGGCCTAAGGTCAGAGG - Intergenic
907892900 1:58652190-58652212 GAGGCGTGACCCAAGATCACAGG + Intergenic
910810942 1:91235730-91235752 GAGACGTGACCATGGAGCAGAGG - Intergenic
916808162 1:168280408-168280430 GAGCCCTGACCCTTGAGCAGTGG + Intergenic
917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG + Intronic
922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG + Intronic
1065625194 10:27623061-27623083 GAGGCGTGACCATAGCTCACTGG + Intergenic
1067740675 10:48893916-48893938 GAGCCATTACCATAGTTCAGAGG - Intronic
1068690301 10:59906857-59906879 CGGCCGTGGGCTTAGATCAGGGG - Intergenic
1073263363 10:102207470-102207492 GAGCTGTGACCTTTGGTCAAGGG - Intergenic
1081796027 11:45820527-45820549 GAGGGATGACTTTAGATCAGAGG + Intergenic
1083860795 11:65418941-65418963 GAGTGGTGACCTTAGGGCAGAGG + Intergenic
1084676895 11:70640605-70640627 GAGCCCTGACCTGGGATCACAGG + Intronic
1085875988 11:80406354-80406376 GAGCTGTGTGCTTATATCAGCGG - Intergenic
1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG + Intergenic
1096760016 12:53833600-53833622 GAGGCCTGACCCTAGACCAGGGG + Intergenic
1100245695 12:92754354-92754376 GAGCCATGACCTCAAATCAGTGG - Intronic
1102624635 12:114225188-114225210 GACCCCTGACCCCAGATCAGTGG - Intergenic
1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG + Intronic
1112324310 13:98433188-98433210 AAGCCGTAACCTAAGAGCAGAGG + Intronic
1113543925 13:111131671-111131693 GGGCAGTGACCTGAGGTCAGGGG + Intronic
1116241493 14:42348811-42348833 AAGCCATGATGTTAGATCAGTGG + Intergenic
1123174238 14:106401719-106401741 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1123182450 14:106482654-106482676 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1202944452 14_KI270726v1_random:14075-14097 GAGCCTTGACCTCAAAGCAGCGG + Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1145256768 17:21329411-21329433 GAGCCGTGAAGTTAGAAAAGTGG - Intergenic
1145319845 17:21758539-21758561 GAGCCGTGAAGTTAGAAAAGTGG + Intergenic
1145869005 17:28258411-28258433 GAGCTGTGCCCTTGGCTCAGAGG - Intergenic
1148340521 17:46870753-46870775 GAGCTGTGCCCTTGGCTCAGAGG + Intronic
1148960438 17:51388030-51388052 GAGTCCTGAACTTAGACCAGTGG - Intergenic
1149122151 17:53182461-53182483 GAGGTGTGACCTTAGATTATAGG + Intergenic
1159340230 18:67125025-67125047 GAGCCATGACCTAACAACAGAGG - Intergenic
1160241310 18:77124994-77125016 GAGCCGGGACCTCAGAGGAGTGG - Intronic
1166878915 19:45914923-45914945 GAGCTGGGACCAGAGATCAGGGG - Intergenic
1167447794 19:49548737-49548759 GATCAGTGAGCTGAGATCAGTGG - Intergenic
925759628 2:7171880-7171902 GACCAGTGACCTTAGAGGAGAGG + Intergenic
927465931 2:23336405-23336427 GGGCCATGACCATAGATCTGAGG - Intergenic
930030476 2:47055580-47055602 GAGCCGTGACCTGGGATCATGGG - Intronic
939964115 2:148593745-148593767 GAGCCTTGGCTCTAGATCAGTGG + Intergenic
944493617 2:200283825-200283847 GAGCAGTGACCATTGATCAAGGG + Intergenic
1169042803 20:2509546-2509568 GAACCGGGATCTTAGATAAGAGG - Intronic
1169345801 20:4827302-4827324 GACCTTTGACCTTAGAGCAGAGG + Intergenic
1172498746 20:35409646-35409668 GAGCCTGGACATTTGATCAGTGG - Intronic
1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG + Intergenic
1179493778 21:41758822-41758844 GGGAAGTGACCTTAGACCAGAGG - Intronic
1179588429 21:42388914-42388936 GAGCCATGACCTTACCACAGCGG + Exonic
1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG + Intronic
950497146 3:13340598-13340620 GAGCCATCCCCTTAGAGCAGCGG + Intronic
954713881 3:52517612-52517634 GGGTCCTGACCTTAGAGCAGGGG - Exonic
957354061 3:79059290-79059312 GAGCTGAGGCATTAGATCAGGGG + Intronic
957553029 3:81731288-81731310 TAGCAGTGATCTTAGTTCAGGGG - Intronic
960332773 3:116382708-116382730 TAAACATGACCTTAGATCAGAGG - Intronic
960814734 3:121660835-121660857 GAGCCGGGCGCTTAGAACAGAGG - Exonic
965845672 3:172958524-172958546 CAGCCATGACCTTAGAACTGAGG - Intronic
970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG + Intronic
978982699 4:114969011-114969033 GAGCCATGACTCTAGACCAGTGG - Intronic
990615914 5:57508254-57508276 GAGCCGTCACCCTAGATGGGGGG - Intergenic
994184823 5:96805943-96805965 GTACCGGGACCTTGGATCAGAGG + Intronic
1001332450 5:170771999-170772021 GAGCAGTGGCCTTAGGTCAGGGG - Intronic
1003016896 6:2475326-2475348 GAACTGTCACCTTAGCTCAGGGG + Intergenic
1004544323 6:16582658-16582680 GTGCTGTGACCTCAGATCTGTGG - Intronic
1006841252 6:37029214-37029236 GAGCTTTGACCTTAGTTCACCGG - Intergenic
1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG + Intergenic
1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG + Intergenic
1027534922 7:79386822-79386844 GATCAGTGACCTTATATGAGAGG + Intronic
1029889882 7:103916539-103916561 GAGACCTGTCCTTAAATCAGAGG - Intronic
1039610768 8:38917625-38917647 AAGCCCAGACTTTAGATCAGGGG - Intronic
1039738347 8:40356402-40356424 GAGTAGTGACCTTTGATCAAAGG - Intergenic
1045345253 8:101288102-101288124 GAGCCGTAACCTTACATGGGCGG + Intergenic
1046317926 8:112531212-112531234 GAGCAGTGGCCTGAAATCAGGGG - Intronic
1047672102 8:127159201-127159223 GAGCCGTGACCTAAATTTAGCGG + Intergenic
1047759918 8:127946846-127946868 GAGTCGTGACCTTGGGTCAAAGG - Intergenic
1047822794 8:128539885-128539907 GAGGGGTGACGTTTGATCAGAGG + Intergenic
1048979207 8:139694127-139694149 GGGCCATGAGATTAGATCAGGGG + Intronic
1052060103 9:23949523-23949545 AAGCCTTGACTCTAGATCAGGGG + Intergenic
1056893276 9:90516190-90516212 GAGCCTTTACCTTAAATAAGGGG + Intergenic
1061921020 9:133782553-133782575 GAGCTGTGATTTTAGATCAATGG - Intronic
1188533055 X:31163690-31163712 GAGGCGTGACCTTGAATGAGAGG - Intronic
1197593818 X:128442872-128442894 GAGCAGTGGCCTTAGATCCAAGG - Intergenic