ID: 1136174981

View in Genome Browser
Species Human (GRCh38)
Location 16:28510434-28510456
Sequence CTAAAAATACAGACCAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10702
Summary {0: 1, 1: 0, 2: 12, 3: 450, 4: 10239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136174981_1136174985 2 Left 1136174981 16:28510434-28510456 CCGAGCTTGGTCTGTATTTTTAG 0: 1
1: 0
2: 12
3: 450
4: 10239
Right 1136174985 16:28510459-28510481 GAGACGGGGTTTCACCATGTTGG 0: 34182
1: 124688
2: 145165
3: 98748
4: 47715
1136174981_1136174987 11 Left 1136174981 16:28510434-28510456 CCGAGCTTGGTCTGTATTTTTAG 0: 1
1: 0
2: 12
3: 450
4: 10239
Right 1136174987 16:28510468-28510490 TTTCACCATGTTGGTAAGGCTGG 0: 131
1: 20443
2: 135465
3: 172465
4: 147691
1136174981_1136174986 7 Left 1136174981 16:28510434-28510456 CCGAGCTTGGTCTGTATTTTTAG 0: 1
1: 0
2: 12
3: 450
4: 10239
Right 1136174986 16:28510464-28510486 GGGGTTTCACCATGTTGGTAAGG 0: 101
1: 13601
2: 104065
3: 177513
4: 185026

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136174981 Original CRISPR CTAAAAATACAGACCAAGCT CGG (reversed) Intronic
Too many off-targets to display for this crispr