ID: 1136176683

View in Genome Browser
Species Human (GRCh38)
Location 16:28521958-28521980
Sequence CTGGTTCACCAGATCTCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136176683_1136176688 -1 Left 1136176683 16:28521958-28521980 CCTCTCGAGATCTGGTGAACCAG No data
Right 1136176688 16:28521980-28522002 GGACATGAAAACAGGGCCCCTGG No data
1136176683_1136176689 4 Left 1136176683 16:28521958-28521980 CCTCTCGAGATCTGGTGAACCAG No data
Right 1136176689 16:28521985-28522007 TGAAAACAGGGCCCCTGGCTTGG No data
1136176683_1136176685 -9 Left 1136176683 16:28521958-28521980 CCTCTCGAGATCTGGTGAACCAG No data
Right 1136176685 16:28521972-28521994 GTGAACCAGGACATGAAAACAGG No data
1136176683_1136176686 -8 Left 1136176683 16:28521958-28521980 CCTCTCGAGATCTGGTGAACCAG No data
Right 1136176686 16:28521973-28521995 TGAACCAGGACATGAAAACAGGG No data
1136176683_1136176690 7 Left 1136176683 16:28521958-28521980 CCTCTCGAGATCTGGTGAACCAG No data
Right 1136176690 16:28521988-28522010 AAACAGGGCCCCTGGCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136176683 Original CRISPR CTGGTTCACCAGATCTCGAG AGG (reversed) Intergenic
No off target data available for this crispr