ID: 1136180907

View in Genome Browser
Species Human (GRCh38)
Location 16:28551262-28551284
Sequence CAGCAACATTTCAGTTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136180907_1136180911 16 Left 1136180907 16:28551262-28551284 CCATCATAACTGAAATGTTGCTG No data
Right 1136180911 16:28551301-28551323 GCATGGTTGCTGTAAGTCATAGG No data
1136180907_1136180908 -1 Left 1136180907 16:28551262-28551284 CCATCATAACTGAAATGTTGCTG No data
Right 1136180908 16:28551284-28551306 GCCCACTTCGAAATATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136180907 Original CRISPR CAGCAACATTTCAGTTATGA TGG (reversed) Intergenic
No off target data available for this crispr