ID: 1136183374

View in Genome Browser
Species Human (GRCh38)
Location 16:28570253-28570275
Sequence CAGTGTGTCCAGAAGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136183362_1136183374 29 Left 1136183362 16:28570201-28570223 CCAGCAAACCTGTACAGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1136183364_1136183374 21 Left 1136183364 16:28570209-28570231 CCTGTACAGGCAGGGCTGCCCAG 0: 1
1: 0
2: 1
3: 34
4: 227
Right 1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1136183365_1136183374 3 Left 1136183365 16:28570227-28570249 CCCAGAGCCCAGCAACATGTCCC 0: 1
1: 0
2: 2
3: 16
4: 222
Right 1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1136183360_1136183374 30 Left 1136183360 16:28570200-28570222 CCCAGCAAACCTGTACAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1136183367_1136183374 -4 Left 1136183367 16:28570234-28570256 CCCAGCAACATGTCCCTGCCAGT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1136183366_1136183374 2 Left 1136183366 16:28570228-28570250 CCAGAGCCCAGCAACATGTCCCT 0: 1
1: 0
2: 0
3: 19
4: 218
Right 1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1136183368_1136183374 -5 Left 1136183368 16:28570235-28570257 CCAGCAACATGTCCCTGCCAGTG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136183374 Original CRISPR CAGTGTGTCCAGAAGGTAGG AGG Intronic
902137225 1:14319634-14319656 CAGGCTGTCGAGAAGGGAGGAGG - Intergenic
902244176 1:15108546-15108568 CAGTGTGCCCAGCACGTAGTGGG + Intronic
902275299 1:15335173-15335195 CAGTGTGTTCGGAAGGGTGGAGG + Intronic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
906607550 1:47182509-47182531 AAGTGGGGCCAGAAGGTAGGAGG - Intergenic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
912173828 1:107134092-107134114 CATTGTGACCAGAAAGCAGGTGG - Intergenic
913075246 1:115336514-115336536 CAGTGTTTCCAGAGGGTCAGAGG - Intronic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
921594929 1:217044336-217044358 GAGTGTGTACAGATGGCAGGAGG - Intronic
921863693 1:220065908-220065930 CAGAGTGTCCAGAAGGGAAGTGG + Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
923232240 1:231997767-231997789 CAGTGGGTTCAGGTGGTAGGAGG - Intronic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
924931193 1:248733696-248733718 AAGCGAGACCAGAAGGTAGGAGG - Intronic
1063131001 10:3176592-3176614 CTGGGTTTCCAGAAAGTAGGAGG - Intergenic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1072762093 10:98065064-98065086 CAGTGTCTCCAGCAGCTATGTGG + Intergenic
1076378685 10:130010454-130010476 CAGTGATTCCAAAAGGGAGGAGG + Intergenic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1076819127 10:132930044-132930066 CAGGGTGTCCAGTAGGGACGTGG - Intronic
1077030370 11:462789-462811 CAGGGTGTCCAGAAGGCTGTGGG + Intronic
1080681251 11:34478163-34478185 CTGCGTGTCCAGAAGGCAGTAGG + Intergenic
1084174142 11:67415069-67415091 CACTGGGTCCAGAAGTGAGGAGG + Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084221565 11:67683637-67683659 CAGTAAGTCCAAAAGGGAGGAGG - Intergenic
1085757680 11:79215316-79215338 AAGGCTGTCCAGAAGGCAGGTGG - Intronic
1086940834 11:92796765-92796787 GAGTATGTAAAGAAGGTAGGTGG - Intronic
1087077158 11:94135751-94135773 CACTATGTGCTGAAGGTAGGTGG + Intronic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1089804108 11:121067709-121067731 CAGTGTGTACTGCAGGTAGCTGG + Intronic
1090475838 11:127019135-127019157 CAGTGTTTTCAGCAGGAAGGAGG + Intergenic
1091243832 11:134074636-134074658 CAGTGTGTTCAAAAAGAAGGGGG - Intronic
1091816927 12:3445915-3445937 CAATGGGGCCAGGAGGTAGGTGG - Intronic
1092645724 12:10569932-10569954 CAGTAATTCCAAAAGGTAGGAGG - Intergenic
1093082181 12:14825268-14825290 CAGTATTTCCAGAAGCCAGGAGG - Intronic
1093639503 12:21509978-21510000 CAGTGTTTGGAGAAGGTCGGGGG + Intronic
1096256411 12:50064672-50064694 CAGTGTGTCCTGGAGGCAGAAGG + Intronic
1098340812 12:69449202-69449224 AAGTGTCTCCAGAAGAAAGGAGG + Intergenic
1099370332 12:81821176-81821198 CAGAGACTCCAAAAGGTAGGAGG + Intergenic
1099596326 12:84671465-84671487 CAGAGACTACAGAAGGTAGGAGG + Intergenic
1100281313 12:93120808-93120830 CAGTGTGTCAAGTAGGGAGGAGG - Intergenic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104781822 12:131426498-131426520 CAGTAGTTCCAGAAGGGAGGAGG - Intergenic
1107790188 13:43994289-43994311 AAGAGTGTGAAGAAGGTAGGAGG - Intergenic
1108174746 13:47780648-47780670 CAATCTGTCCATAGGGTAGGGGG + Intergenic
1108590915 13:51912225-51912247 CAGTGTGTGCAGCAGGTATTCGG + Intergenic
1109293070 13:60498929-60498951 CAGTGGGTCCAGTGGGTACGCGG + Intronic
1109371542 13:61427139-61427161 GAGAGTCTCCAGATGGTAGGAGG - Exonic
1113229163 13:108194343-108194365 AAGTGTTTCCAGATCGTAGGTGG + Intergenic
1113823917 13:113235610-113235632 CAGTGTGTCCATATGATGGGAGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1119181044 14:72605498-72605520 CAGTGTGTCCCCAAGGTGGGTGG - Intergenic
1119317837 14:73710220-73710242 CAGTGTGTCAAGAGTGTAAGAGG + Intergenic
1119945445 14:78688613-78688635 CATGGTGTCAAGAAGATAGGTGG + Intronic
1121121380 14:91377845-91377867 CAGTGCGTGCAGCAGGAAGGAGG + Intronic
1121302192 14:92880725-92880747 CAATGTGACCAGGAGGCAGGTGG - Intergenic
1121395882 14:93622800-93622822 CAGTTTGTCCAGAATGTTGAAGG - Exonic
1121810355 14:96882191-96882213 CAGTGTGTTTAGAAGGTATATGG + Intronic
1122141611 14:99666387-99666409 CTGTGTGTGCAGAGGGTTGGGGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126735427 15:51727709-51727731 CAGTATGTACAGAAGCCAGGGGG - Intronic
1127482665 15:59391673-59391695 CAGGGCAGCCAGAAGGTAGGGGG + Intronic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1130374132 15:83312930-83312952 CAGTGTGTCCAGCATGTTGCAGG + Intergenic
1130679269 15:85981967-85981989 CTGTGTGTCCACAACGGAGGAGG + Intergenic
1131116303 15:89798140-89798162 AAATGTGTACAGAAGGCAGGAGG - Intronic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1132215796 15:100060785-100060807 CAGCGTGGGCTGAAGGTAGGTGG + Intronic
1202967473 15_KI270727v1_random:194523-194545 CAGCATGTCCAGGAGGCAGGTGG + Intergenic
1133466395 16:6031241-6031263 CAGTGTGTTCAGAAGCCCGGGGG + Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1138008544 16:53358190-53358212 CAGTGTGTCCAGTAGAGTGGAGG - Intergenic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1139385318 16:66565108-66565130 CAGTGTGGTCAGAACCTAGGAGG + Intronic
1139670913 16:68492159-68492181 CAGTGTTTCCAAAAGCTGGGAGG + Intergenic
1139698993 16:68695677-68695699 CAGAGTATCCAAAGGGTAGGGGG + Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1139936247 16:70573415-70573437 CACTCCGTACAGAAGGTAGGGGG + Exonic
1140001507 16:71029874-71029896 CTGTGAGCCCAGAAGGCAGGGGG + Intronic
1140728361 16:77834142-77834164 GTGTGTGTCCAGAAGCTAAGGGG - Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1143039746 17:4025085-4025107 CAGCTGGTCCAGAAGGGAGGAGG - Exonic
1144738630 17:17568895-17568917 CAGGGTGGCCAGACGGTAGGTGG - Intronic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1145819119 17:27817783-27817805 CAATATGTGCAGAAGGAAGGAGG + Intronic
1146638163 17:34521164-34521186 CAGTGAGTCTAGAAGGTAGGTGG - Intergenic
1147158506 17:38557687-38557709 TAGTGTTTTCAGAAGGAAGGAGG - Intronic
1147377891 17:40033616-40033638 CACTGTTTCCAGAAGGGGGGTGG + Intronic
1147721578 17:42543007-42543029 CACTGTGGACAGGAGGTAGGGGG - Exonic
1148543925 17:48502503-48502525 CAGTTTGGCCAGAAGGTGGCTGG + Intergenic
1148611680 17:48968835-48968857 CCCTGTGCCCAGAAGGGAGGAGG - Intergenic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1151599970 17:75100139-75100161 CAGGTTCTCCAGAAGGTAGCGGG - Exonic
1151975197 17:77480529-77480551 CACTCTGCCCAGAAGGTGGGAGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152383048 17:79952118-79952140 CGGCGTGTCCAGAAGCTGGGGGG - Intronic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1152916455 17:83039296-83039318 CAGTGTGTCTAGAAGAGGGGCGG - Intronic
1152916485 17:83039408-83039430 CAGTGTGTCTAGAAGAGGGGCGG - Intronic
1152916495 17:83039446-83039468 CAGTGTGTCTAGAAGAGGGGCGG - Intronic
1153215910 18:2821029-2821051 CTGTGTTTCCAGACTGTAGGTGG - Intergenic
1154208056 18:12354682-12354704 CTGTGGGTCCAGATGATAGGAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156196698 18:34782293-34782315 CAGTTTCTCCAGAAGATACGTGG - Intronic
1158718720 18:59904406-59904428 CAGTGTGGTCAGAAGGTCAGAGG - Intergenic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1160439274 18:78876531-78876553 CATGGTGTCCAGCAGATAGGGGG - Intergenic
1160726064 19:618313-618335 CTGTGTGCCCCGAATGTAGGTGG - Intronic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1162743468 19:12786347-12786369 CAGTGGGGCCAGCAGGGAGGGGG + Intronic
1163345192 19:16736799-16736821 CAGTTTGTCTAGAAAGCAGGGGG - Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1164479155 19:28598185-28598207 CAGTGATTCCAAAAGGCAGGAGG + Intergenic
1165993397 19:39828289-39828311 CAGCTTGGCCAGAGGGTAGGGGG - Exonic
1166254127 19:41590210-41590232 GACTTTGGCCAGAAGGTAGGGGG - Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
925057290 2:864992-865014 CTGTGAGTCCAGCAGGTAGCTGG + Intergenic
926718901 2:15943947-15943969 CAGTGTTTTCAGAATGCAGGTGG + Intronic
926998608 2:18768419-18768441 CAAAGTAGCCAGAAGGTAGGGGG - Intergenic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
929860519 2:45673128-45673150 CAGAGAGTTCAGAAAGTAGGGGG - Intronic
932982289 2:76684411-76684433 CAGTCTGTCCAGACAGGAGGAGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935194617 2:100805201-100805223 CAGTCTGTCCTGAAGACAGGGGG - Intergenic
939737990 2:145873281-145873303 CATAGTTTCCAGAAGATAGGTGG + Intergenic
942655334 2:178208988-178209010 CAGTAAGTTCAGAAGCTAGGGGG - Intronic
943041127 2:182806878-182806900 CAGTGTGTCTAGAAGGGATAAGG - Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
945198258 2:207257298-207257320 CAGTGGGTGCAGCAGGTAGAAGG + Intergenic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
948830948 2:240598027-240598049 CTCTGTGTCCGGCAGGTAGGTGG - Exonic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171164290 20:22957010-22957032 CAGTGCTACCTGAAGGTAGGGGG - Intergenic
1171174704 20:23042913-23042935 AAGTGACTCCAGAAGGTAGGAGG + Intergenic
1172184741 20:33024331-33024353 CAGTGTGACCAGAAGGGCAGAGG - Intergenic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1174080773 20:47969363-47969385 CAGGGTGTCCACAAAGGAGGCGG + Intergenic
1179363608 21:40735551-40735573 CAGTGTGTCTGGAATGTAGGTGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181597261 22:23924216-23924238 CAGTGTGGCCAGAAGTTTTGTGG - Intergenic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
952973189 3:38669704-38669726 TAGCTTGTTCAGAAGGTAGGTGG - Intergenic
954150016 3:48652654-48652676 CTGTGGGTCCAGGAGGGAGGGGG - Intronic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954283709 3:49602877-49602899 CAGAGTGTGCAGAAGAGAGGAGG - Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
961613637 3:128161461-128161483 TAGTGTGTACAGAAGGCAAGAGG - Intronic
962368060 3:134798616-134798638 CTTTGTGTCCAGAAGGCAGGAGG - Intronic
962986643 3:140542140-140542162 CAATGTGTCCAACAGGTAAGAGG - Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963331973 3:143924578-143924600 CAGTGGGTCCAGCAGGTACCTGG - Intergenic
964260385 3:154828736-154828758 CAGTGTATGCAGAACCTAGGGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968985287 4:3871566-3871588 CGGTGTGGCCAGGAGGGAGGTGG - Intergenic
969179093 4:5423774-5423796 CAGTGAGTCCAGAGGGGTGGTGG + Intronic
969649898 4:8459852-8459874 CAGTGTGTGCAGCAGGTTCGAGG + Intronic
971300914 4:25441800-25441822 CAGTGTGTGCAAAAGCTTGGAGG + Intergenic
971329136 4:25667977-25667999 GAGTGAGTTCAGAAGGTAAGAGG + Exonic
972950248 4:44312907-44312929 CAATGTGTCCAGTTGGGAGGAGG + Intronic
973775241 4:54235664-54235686 CCATGTCTCCAGGAGGTAGGAGG + Intronic
975674383 4:76811980-76812002 CAGTGTGGCCAGCAGATATGTGG - Intergenic
976600938 4:86936467-86936489 CGGTGTGTGTAGAAGGTAGGTGG + Intronic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980592304 4:134906094-134906116 AATTGTGTTCAGAAGGGAGGGGG - Intergenic
981121399 4:141055288-141055310 CACTGTGTCCAGATGATAAGCGG - Intronic
984496156 4:180499465-180499487 TAATGTGGCCAGAAGGTTGGAGG - Intergenic
986326974 5:6683297-6683319 CTCTGTGTCCAAAAGGTAGAAGG - Intergenic
986854040 5:11848549-11848571 CATTGTGTAAATAAGGTAGGGGG - Intronic
989609483 5:43277529-43277551 CAATGTCTGCAGAAGCTAGGAGG - Intronic
991973590 5:72164284-72164306 CAGGGTTTTCACAAGGTAGGAGG + Intronic
992102807 5:73423540-73423562 CAGGGTCCCCAGTAGGTAGGTGG + Intergenic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
997881879 5:137599006-137599028 CAGTATGTCCACATGGCAGGAGG + Intergenic
998474567 5:142409417-142409439 CAGTTTGCCCAGCAGGCAGGAGG - Intergenic
999117248 5:149174671-149174693 CAGTGTATCCTGAAGGAAAGAGG - Intronic
999247007 5:150160421-150160443 CTGAGTGTCCAGGAGGTAGGGGG - Intergenic
1001868154 5:175123802-175123824 CAGTGTCTTCTGAAGGAAGGAGG + Intergenic
1002094874 5:176824806-176824828 CAGAGAGTACACAAGGTAGGGGG - Intronic
1002701908 5:181130509-181130531 CAGGGTGTCCTGGAGGCAGGTGG - Intergenic
1002703889 5:181147637-181147659 CAGGGTGTCCTGGAGGCAGGTGG + Intergenic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1005218992 6:23564461-23564483 CACAGTGTGCAGAAGGTAAGAGG - Intergenic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1012868754 6:104648287-104648309 AAGTGTGTCCAGATGGAATGTGG + Intergenic
1015555228 6:134454190-134454212 CATTGTGTGGAGAAGGTTGGAGG - Intergenic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1017589695 6:155965593-155965615 CAGTGAGCCTAGGAGGTAGGTGG - Intergenic
1018158313 6:161011454-161011476 AAGTGTGTGAAGAAGGGAGGGGG - Intronic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1021466051 7:20944659-20944681 CGGTGTGTCCAGAGTGTTGGAGG + Intergenic
1022028946 7:26474368-26474390 CAGTTTGTTCAGAAACTAGGTGG - Intergenic
1024351218 7:48366898-48366920 CAGTGTGTCGGCAAGGTGGGAGG - Intronic
1024588028 7:50857876-50857898 CAGTTTGGCCAGCAGGTATGGGG + Intergenic
1027224299 7:76234369-76234391 CAGTGTTTCCAGAACAAAGGAGG + Intronic
1030504127 7:110398312-110398334 CAGAGTGTCAAGCAAGTAGGAGG + Intergenic
1030963095 7:115951636-115951658 TAGTGTGTCCTGGAAGTAGGGGG + Intronic
1032517941 7:132520799-132520821 CTGTGGGGCCAGAAGGTGGGTGG - Intronic
1033369273 7:140694458-140694480 TAGTGTGTCCAGTAGATGGGAGG + Intronic
1036658440 8:10692368-10692390 AAGGGTTTCCAGCAGGTAGGGGG - Intronic
1036660280 8:10703333-10703355 CAGTATGTCCAGGAGCTGGGAGG + Intronic
1037944829 8:22982260-22982282 CAGTGTGTCCCGACAGCAGGTGG - Intronic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038456085 8:27672672-27672694 CAGTGTGTGCAGGAAGTTGGTGG - Exonic
1038542768 8:28402751-28402773 CTGTGTGTGCAGGAGGCAGGAGG - Intronic
1041777290 8:61537210-61537232 CACTGTTTCCAGCTGGTAGGTGG - Intronic
1044021287 8:87109221-87109243 AAGTGTATCCAGCCGGTAGGGGG + Intronic
1044969464 8:97605204-97605226 CACCCGGTCCAGAAGGTAGGGGG + Intergenic
1045498966 8:102730562-102730584 CAGTGAGTCCAGGTGGGAGGTGG - Intergenic
1046701671 8:117407778-117407800 CAGTGTCACCATAATGTAGGAGG + Intergenic
1047410300 8:124619231-124619253 CGGTGTGTACAGAAGCTGGGAGG - Intronic
1049323007 8:142007190-142007212 CTGTGTGTCCAGAAGGGCTGAGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1053014494 9:34654253-34654275 CAGTGTGTCTATATGGCAGGTGG - Intronic
1053277492 9:36794438-36794460 CAGTGTGTGGAGGAGGCAGGAGG - Intergenic
1055873371 9:80913256-80913278 GAGTTTGTCCAGGAGGTAGCAGG - Intergenic
1057992135 9:99781678-99781700 GAGAGTGTCCAGAAGGGAAGAGG - Intergenic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1060423594 9:123486767-123486789 GAGGGTGCCCAGAAGGTTGGGGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061134184 9:128723923-128723945 CAGTGTGACCAGAACGTCTGGGG + Intronic
1061484107 9:130911729-130911751 AACTGTGTCCGGAAGGCAGGGGG + Intronic
1061956154 9:133962244-133962266 CAGTGTCTTCTGAAGGCAGGAGG + Intronic
1185839609 X:3376369-3376391 CAGTGATTCCAAAAGGGAGGAGG - Intergenic
1189823975 X:44898516-44898538 CTGTGTGTGCAGGAGGGAGGTGG + Intronic
1191669427 X:63735340-63735362 CTTTGTTTCCAGAAGGTAGGAGG + Intronic
1192095532 X:68206823-68206845 CCCTGTGTGCAGTAGGTAGGTGG - Intronic
1196162068 X:112496251-112496273 CACTGTGTCCACAAGGTATGAGG + Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1200060051 X:153480152-153480174 CAGTGTGTCCCAAGGGTGGGGGG - Intronic
1200308380 X:155052489-155052511 CAGGGTGTCAAGAAGATAGCTGG + Intronic
1201236206 Y:11914495-11914517 CAGTGATTCCAAAAGGGAGGAGG + Intergenic