ID: 1136183836

View in Genome Browser
Species Human (GRCh38)
Location 16:28573303-28573325
Sequence CTCCCTTCTCCTCTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 31, 3: 113, 4: 714}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136183836_1136183842 25 Left 1136183836 16:28573303-28573325 CCTGAAGCCAGAGGAGAAGGGAG 0: 1
1: 0
2: 31
3: 113
4: 714
Right 1136183842 16:28573351-28573373 CACATCGGAAGCAGCAGAGAGGG 0: 1
1: 0
2: 3
3: 27
4: 240
1136183836_1136183841 24 Left 1136183836 16:28573303-28573325 CCTGAAGCCAGAGGAGAAGGGAG 0: 1
1: 0
2: 31
3: 113
4: 714
Right 1136183841 16:28573350-28573372 CCACATCGGAAGCAGCAGAGAGG 0: 1
1: 0
2: 1
3: 16
4: 185
1136183836_1136183839 10 Left 1136183836 16:28573303-28573325 CCTGAAGCCAGAGGAGAAGGGAG 0: 1
1: 0
2: 31
3: 113
4: 714
Right 1136183839 16:28573336-28573358 TCAAGATCAGTAGGCCACATCGG 0: 1
1: 0
2: 0
3: 7
4: 82
1136183836_1136183838 1 Left 1136183836 16:28573303-28573325 CCTGAAGCCAGAGGAGAAGGGAG 0: 1
1: 0
2: 31
3: 113
4: 714
Right 1136183838 16:28573327-28573349 AGCATCATGTCAAGATCAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136183836 Original CRISPR CTCCCTTCTCCTCTGGCTTC AGG (reversed) Intronic
900189427 1:1347057-1347079 CTCCCTGGTCCTCTGGCTGGTGG - Intronic
900231156 1:1558782-1558804 CTCCCTCCTCCTCTACCCTCTGG + Intronic
900476008 1:2876694-2876716 ATGCCTTCTCCTGTGGCTTTGGG - Intergenic
900623349 1:3597192-3597214 ATGCCTACTCCTCTGCCTTCTGG + Intronic
900666593 1:3819716-3819738 CTCCCTTCTCTCCTGCCTGCAGG - Intronic
901797112 1:11686243-11686265 CTCCGCTCTCATCTGCCTTCTGG + Intronic
902097801 1:13960835-13960857 CTCCCCTCTCCTGGGGCTTCAGG + Intergenic
902236918 1:15063550-15063572 TCCTCTTCTCCTCTGGCTACAGG + Exonic
902354040 1:15882991-15883013 CTCCTTTCCCCTCTCTCTTCTGG - Intronic
902747745 1:18484501-18484523 CTCCCATCTCCCCTGGCTTCTGG - Exonic
903474635 1:23611055-23611077 CCCCATTGCCCTCTGGCTTCTGG - Intronic
903647492 1:24904073-24904095 CTCCCTTCTACTCTGGCAGCCGG + Intronic
904360995 1:29971721-29971743 CTCTCTTCTCCTTTGCCTTTGGG + Intergenic
904426037 1:30423771-30423793 CTTCCTCATCCTCTGCCTTCTGG - Intergenic
904477453 1:30774498-30774520 GTCCCTTCCCCTCTGACTGCTGG + Intergenic
904910023 1:33927771-33927793 CTCCCTTCTCTTCTGCCTGGGGG + Intronic
905385830 1:37603441-37603463 CTCCCTTCTCCTTTGGCCTCAGG - Intergenic
906076948 1:43058827-43058849 CTCCCATCTCCCCAGGCTTAGGG + Intergenic
906832040 1:49043270-49043292 CTCCTTTGTTCTCTGGATTCTGG + Intronic
906892391 1:49731020-49731042 CTCCCTTATTCTCCAGCTTCTGG + Intronic
906920066 1:50054821-50054843 CTCCCTTGCACTCTTGCTTCTGG + Intronic
906937532 1:50227096-50227118 CTTCCTTGCCCTCAGGCTTCTGG + Intergenic
907088812 1:51705255-51705277 CTCCCATCTCCTGGGGCTGCAGG + Intronic
907107730 1:51899452-51899474 CTCCTTTGCCCTCTGGCTTTTGG + Intergenic
907546814 1:55268471-55268493 GTCCCTTCTCTTCTGTTTTCTGG + Intergenic
907576691 1:55533044-55533066 CTCCCTTCTCCATAGGCTCCTGG + Intergenic
907857022 1:58313522-58313544 ATGTCTTATCCTCTGGCTTCTGG - Intronic
908414294 1:63897967-63897989 CTTCCCTCTCCTCTGTCTCCTGG - Intronic
908529528 1:65021093-65021115 TTCTCTTGTCTTCTGGCTTCTGG - Intergenic
908797660 1:67847110-67847132 CTCCCTTGTCCTCTAGCTTCTGG + Intergenic
908815344 1:68026444-68026466 TGCCCTTCTCCTCAGGTTTCAGG - Intergenic
909044922 1:70698452-70698474 CTCCTGTGTCCTCTGGCTTGTGG - Intergenic
909236974 1:73164987-73165009 CTACCTGGCCCTCTGGCTTCTGG - Intergenic
909591332 1:77352414-77352436 CTCCCTTGTTTACTGGCTTCAGG - Intronic
909809837 1:79918908-79918930 CTCCCTTATTCTCTGGTTTCTGG - Intergenic
909917324 1:81336613-81336635 CTCCCTGCTCCTTTGGATTATGG - Intronic
910302825 1:85726756-85726778 TTCCCACCTCCTCTGGCCTCTGG + Intergenic
910985593 1:93002116-93002138 CTTCCAAGTCCTCTGGCTTCTGG + Intergenic
910992147 1:93067489-93067511 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
911316161 1:96359131-96359153 TTCCCATGTTCTCTGGCTTCTGG - Intergenic
911546783 1:99226773-99226795 CTCCCCTCTCTCCTGGCTGCTGG + Intergenic
911706543 1:101020424-101020446 CTCCCTCCTCCTCTGGCTCCAGG + Intronic
911758504 1:101588856-101588878 CTCCCTTCTCCACTGGGCTGAGG + Intergenic
911831852 1:102560295-102560317 CTCTCTTCTCTTTTGGCTTCAGG - Intergenic
911908069 1:103594759-103594781 CTCCCATCTCCTTTGGGTCCTGG + Intergenic
911910431 1:103627796-103627818 CTCCCATCTCCTTTGGGTCCCGG + Intergenic
911913603 1:103667240-103667262 CTCCCATCTCCTTTGGGTCCTGG + Intronic
911914849 1:103684707-103684729 CTCCCATCTCCTTTGGGTCCTGG - Intronic
911917849 1:103721921-103721943 CTCCCATCTCCTTTGGGTCCCGG + Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912583285 1:110738664-110738686 TTTCCTTGTCTTCTGGCTTCAGG + Intergenic
912799785 1:112713743-112713765 CTCCCTTCTCCTCCTCCCTCTGG - Intronic
912816482 1:112832825-112832847 CACCTTCCTCCTCTTGCTTCTGG - Intergenic
912878684 1:113388692-113388714 CTCCCTTGCCCTCTGGCGTCTGG + Intergenic
913100533 1:115560078-115560100 GTCTCTTGTCCTCTGGCTTCTGG - Intergenic
913110106 1:115649931-115649953 TTCACTTCTCCTCTGCCATCAGG - Intronic
913542170 1:119832066-119832088 TTTCCTTCTCCTCTGGCCTTTGG - Intergenic
913590397 1:120319367-120319389 CTTCCTACTGCTCTGCCTTCTGG + Intergenic
913617789 1:120578996-120579018 CTTCCTACTGCTCTGCCTTCTGG - Intergenic
913965280 1:143371943-143371965 TTTCCTCCTCCTCTGGCTTTTGG + Intergenic
914059656 1:144197545-144197567 TTTCCTCCTCCTCTGGCTTTTGG + Intergenic
914119494 1:144768826-144768848 TTTCCTCCTCCTCTGGCTTTTGG - Intergenic
914359524 1:146921132-146921154 ATCCCTTCTACACTGACTTCAGG + Intergenic
914494227 1:148178743-148178765 ATCCCTTCTACACTGACTTCAGG - Intergenic
914572482 1:148931976-148931998 CTTCCTACTGCTCTGCCTTCTGG + Intronic
914969427 1:152293644-152293666 CCCCTCTCTCTTCTGGCTTCTGG - Intergenic
915356405 1:155257524-155257546 CTCCCTGCTCCTTTGTCTGCTGG - Exonic
915453360 1:156022421-156022443 CTCCAATCTGCTCTGACTTCAGG + Intergenic
915519157 1:156431183-156431205 CTCCCTTATCCCCTGGTTACTGG - Intergenic
916362175 1:163982915-163982937 CTGCCTTCTTCTCAGGATTCAGG - Intergenic
917285287 1:173416424-173416446 CTTCCCTCTCCTCTGCCCTCTGG - Intergenic
917612132 1:176699478-176699500 GTCCCTTGTGCTCTGGCTGCAGG + Exonic
917729308 1:177858394-177858416 CAGCCTGCTCCTCTGGCTTTAGG - Intergenic
918195864 1:182220588-182220610 CCCCACTCTCTTCTGGCTTCTGG - Intergenic
918760423 1:188397445-188397467 TTCCCTTCACCTCAGGCCTCGGG - Intergenic
919630383 1:199954920-199954942 CTCCCCTGTCCCCTGGCTTTTGG - Intergenic
919746021 1:201009583-201009605 CTTCCTTTTCCTCTGGCTCATGG - Intronic
919939240 1:202275123-202275145 ATCACTTCTCCTTTGGGTTCAGG + Intronic
920002918 1:202811595-202811617 CTCCCTTCCGCCCTGGCCTCCGG + Intergenic
920048052 1:203146285-203146307 TTCCCTTCGCCACTGTCTTCAGG + Intronic
920396367 1:205648874-205648896 CTCCCTCCTCCTCTCCCATCAGG + Intergenic
920674026 1:208026546-208026568 TTCCATACTCCTCTGGCTGCCGG + Exonic
920866854 1:209760249-209760271 TGCCCTTCTCCTCTAGCTCCAGG - Exonic
921410619 1:214832608-214832630 CATGCTTCTCCCCTGGCTTCCGG + Intergenic
921516181 1:216095478-216095500 CTTCCTTTCCCTCTGGCTGCAGG + Intronic
921550221 1:216526459-216526481 CTCCTGTCTCTCCTGGCTTCTGG - Intronic
921926459 1:220713726-220713748 CTCCCTCTTCCTCTGGCTAGAGG + Intergenic
922543052 1:226433580-226433602 CCCCCTTCTCCTCCGGCTTCTGG + Intergenic
922614167 1:226951350-226951372 CTCCCTCCTCCTGTCGCTTCAGG - Intronic
922679125 1:227576282-227576304 GTCCCTTCTCCTCAAGCTTTTGG + Intronic
922831568 1:228557064-228557086 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922832045 1:228609046-228609068 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922832606 1:228611287-228611309 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922833166 1:228613528-228613550 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922833727 1:228615769-228615791 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922834286 1:228618010-228618032 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922834846 1:228620241-228620263 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922835395 1:228622444-228622466 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922835954 1:228624686-228624708 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922836513 1:228626926-228626948 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922837071 1:228629167-228629189 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922837630 1:228631409-228631431 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922838189 1:228633650-228633672 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922838748 1:228635875-228635897 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922839306 1:228638115-228638137 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922839867 1:228640346-228640368 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922840428 1:228642587-228642609 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922840990 1:228644818-228644840 CTCCCTCCGCCTCTCTCTTCTGG - Intergenic
922841557 1:228647025-228647047 CTCCCTCCTCCTCACTCTTCTGG - Intergenic
922877631 1:228952520-228952542 CTCCCCTCTACTCTGGCCTCCGG + Intergenic
923205439 1:231754335-231754357 CTGGCATCTGCTCTGGCTTCTGG + Intronic
923220766 1:231891060-231891082 CTTCCTTGTCCTCTGGCTGAAGG + Intronic
923234258 1:232017275-232017297 ACTCCTTCTCCTCTGGCTTGAGG - Intronic
923638673 1:235727880-235727902 GTACCATCTCCTCTGGCTTATGG - Intronic
923665968 1:235998995-235999017 CGCCCTTCTGGTCTGGCATCTGG + Intronic
923940271 1:238815986-238816008 CTCCCTTTGCTTCTGTCTTCTGG + Intergenic
923966134 1:239140984-239141006 CTGCCTCCACCTGTGGCTTCCGG + Intergenic
923978829 1:239297213-239297235 CTCCCTTATCCTCTGACTTTGGG + Intergenic
924384800 1:243490795-243490817 CTCCCCTCCCCTCTGCTTTCAGG + Intronic
924738675 1:246781589-246781611 ATCCCTCCTCCTGTGGCTTCAGG - Intergenic
1062855059 10:775874-775896 CTCGGTTCCCCTCTGGCCTCAGG + Intergenic
1062911155 10:1213338-1213360 CTCCCTCCTCCTCTCGCTCTCGG - Intronic
1062951784 10:1508915-1508937 TTTCCTTCTCCTCTGGCTTCAGG + Intronic
1062972052 10:1655351-1655373 CTCCCTTCTCTTCTGCATTAGGG - Intronic
1063707454 10:8444637-8444659 CTCAATTCTCCTCTGGCTGCGGG + Intergenic
1064506505 10:16036310-16036332 CTCACTTCCTCTCTGGATTCTGG + Intergenic
1064749138 10:18508368-18508390 CTCCCTTCCTCTGTGGATTCAGG - Intronic
1065458649 10:25933984-25934006 CTCCCTTCTCGCCGGGCTCCGGG + Intergenic
1065838729 10:29682277-29682299 CTGCCTTCTCCTCTGGCTATGGG - Intronic
1065947909 10:30624226-30624248 TTCCCATGTCCTCTGACTTCTGG + Intronic
1066062682 10:31737940-31737962 GTCCCTTGTCCTGTTGCTTCTGG + Intergenic
1067509199 10:46881464-46881486 TTCCCTTCCCCTTTGGCCTCAGG - Intergenic
1067653054 10:48170391-48170413 TTCCCTTCCCCTTTGGCCTCAGG + Intronic
1068534991 10:58231491-58231513 CTCCACTCTCTTCTGGCTTTAGG - Intronic
1068779062 10:60899942-60899964 CTCCCTTCCCCAAGGGCTTCTGG - Intronic
1068939337 10:62665309-62665331 CTTCCTTGTCTTGTGGCTTCTGG - Intronic
1069274235 10:66569138-66569160 CTCCTTTGTTCTCTGGCTTCTGG - Intronic
1069773752 10:70915149-70915171 CTCCCTTCCCAACTGACTTCTGG - Intergenic
1070406748 10:76104359-76104381 CTCCATTGCCCTCTGGCTTCTGG + Intronic
1070590440 10:77796892-77796914 CTCCATTCTCCTCTGCTCTCTGG + Intronic
1071095256 10:81966382-81966404 CTGCCTTATCCTCTTGTTTCTGG + Intronic
1071365989 10:84901119-84901141 CTCTCTTTGCCTCTGGCTTCTGG + Intergenic
1071516164 10:86299285-86299307 CTCCCTTCTTTCCTGGCCTCTGG + Intronic
1073062926 10:100742990-100743012 CTGCCTTCTCCTGGGGCTCCAGG - Intronic
1074046569 10:109844820-109844842 CTCCCTTCTCCCTTGACTCCTGG - Intergenic
1075229103 10:120657400-120657422 CTCCCTTCAGCTCTGTCTTGGGG - Intergenic
1075262377 10:120974405-120974427 CTCTCTTGCCCTCTTGCTTCTGG + Intergenic
1075596062 10:123730036-123730058 CTTCATTCTGCTCTGGCTTAGGG - Intronic
1076090385 10:127680565-127680587 CTCCTTTCTCTCCTGGCCTCAGG - Intergenic
1076323444 10:129601401-129601423 CTTCATTCTCCTTTGGCTTAAGG + Intronic
1077304855 11:1864443-1864465 CTCCCTCCGCCTCTGCCCTCAGG - Intronic
1077309620 11:1882569-1882591 CTCCCTTCTCCCTTGGCCTCAGG + Intronic
1077328624 11:1974291-1974313 CACCCATCTCCTCTGGGTTGAGG + Intronic
1077561314 11:3263503-3263525 CAGCCTTCTTCTCTGGCTTAAGG + Intergenic
1077567210 11:3309332-3309354 CAGCCTTCTTCTCTGGCTTAAGG + Intergenic
1077652725 11:3988249-3988271 CCACCCTCTGCTCTGGCTTCAGG - Intronic
1078469982 11:11578965-11578987 CTCTCTTGCCCCCTGGCTTCAGG + Intronic
1078586801 11:12598899-12598921 CTCCCTTCTGCTTTGACTCCAGG + Intergenic
1078650483 11:13186244-13186266 CTCCTTTGCCCTCTGCCTTCTGG - Intergenic
1078705617 11:13740937-13740959 TTCCCTTGCCTTCTGGCTTCCGG + Intergenic
1078929346 11:15901307-15901329 TTCCATCCTCCTCTGGCTCCAGG - Intergenic
1079094663 11:17502618-17502640 CTCCCTTCTCCCCTAGCTAAAGG - Intronic
1080077710 11:28171020-28171042 ATCCCATCTCTTCTGTCTTCTGG + Intronic
1080599723 11:33809765-33809787 CTCTCTTCTCCTCTTTCTCCAGG + Intergenic
1080865641 11:36192481-36192503 CTGCCTTCTCCTCTAGTTTGTGG - Intronic
1081596142 11:44460872-44460894 CTCCCCTGCCCTCAGGCTTCTGG - Intergenic
1081599631 11:44484193-44484215 CTCCCTCCTCCTCAGGCTGGCGG - Intergenic
1082067884 11:47915591-47915613 TTCCCTTACCCTCTGGCTTCCGG + Intergenic
1083337119 11:61929428-61929450 CTCACTGCACCTCTGCCTTCTGG - Intergenic
1083488740 11:62999621-62999643 CCCCATTCTCTTTTGGCTTCTGG + Intronic
1083955246 11:65979243-65979265 CTTCCTTCTCCCCTGGCTGTCGG + Exonic
1084115696 11:67041801-67041823 TTCCCTTGGCCTTTGGCTTCTGG - Intronic
1084429005 11:69101124-69101146 GCCCCTTCTCCACTGGCCTCAGG + Intergenic
1084440944 11:69172844-69172866 GTCCTTTGCCCTCTGGCTTCTGG - Intergenic
1085720867 11:78911423-78911445 CTCCCTTGCCCACTGGCTTCTGG + Intronic
1085749395 11:79147603-79147625 CTATCTTCTCCTCTGGCTAAAGG + Intronic
1086003495 11:82008130-82008152 CTCCCTCATCCTCAGGTTTCTGG + Intergenic
1087312828 11:96569819-96569841 CCCTCTTATCCTCTGGATTCAGG + Intergenic
1087532515 11:99402607-99402629 TTCCCTCCTCCTCTAGTTTCTGG + Intronic
1087533257 11:99410556-99410578 CTCTCTTCTTCTCTGGTTTTGGG - Intronic
1087791194 11:102407731-102407753 CATGCCTCTCCTCTGGCTTCTGG - Intronic
1088426475 11:109710186-109710208 CTCCCATCTGCTCTTGCTACTGG - Intergenic
1089025486 11:115265361-115265383 CTTCCTGGGCCTCTGGCTTCTGG + Intronic
1089199395 11:116714744-116714766 CTGCCTTCTCTCCTGGCCTCTGG - Intergenic
1089626500 11:119754515-119754537 CTCTCTTACCTTCTGGCTTCTGG - Intergenic
1090608955 11:128453008-128453030 CTTCCTTCTCCTCTTTCCTCTGG - Intergenic
1090926039 11:131251231-131251253 CTCCCCTCTCCCCTGTCTTTGGG - Intergenic
1091245603 11:134091784-134091806 CTCCCTTCTTCCCTTGCCTCAGG - Intronic
1202811603 11_KI270721v1_random:29470-29492 CACCCATCTCCTCTGGGTTGAGG + Intergenic
1091724588 12:2836855-2836877 CACGCCTCTCCCCTGGCTTCTGG - Intronic
1092904302 12:13088063-13088085 CTCCCTCTTCCTCTGGTTTCTGG - Intronic
1093172938 12:15879363-15879385 CTCCCTTGTCTTCTGGGCTCTGG + Intronic
1093347017 12:18050461-18050483 CTCCATTCTTTTCTGGCTTCTGG + Intergenic
1093416327 12:18925100-18925122 CTCCCTCCACCACTGGATTCTGG - Intergenic
1093655529 12:21689585-21689607 CTCCAATCTCTTCTGGCTTGTGG - Intronic
1095488071 12:42704973-42704995 CTCCCTTCCCCACTGGCTCCAGG + Intergenic
1095945917 12:47753369-47753391 CTAGCTTCCCATCTGGCTTCAGG + Intronic
1096116939 12:49060369-49060391 CTCCCTTCCCCTCTGGCCTCGGG + Intergenic
1096190722 12:49616701-49616723 CTCCCTGCTGACCTGGCTTCTGG - Intronic
1096197485 12:49657969-49657991 TTCCCTTCACCTCTTCCTTCAGG - Intronic
1096488052 12:51996816-51996838 CTACCTGCACCTCTGGATTCTGG + Intronic
1096512320 12:52137889-52137911 CTCCCATCTGCTCTGGCTGGGGG + Intergenic
1097009203 12:55940480-55940502 CTGCCTTCTCCACGGGCCTCCGG + Intronic
1097040985 12:56155784-56155806 ATCCCTTTTCCTCTGCCCTCCGG - Intronic
1097423594 12:59413304-59413326 CTTCCTCATCCTCTGGCTCCTGG + Intergenic
1097685029 12:62683263-62683285 CTTCCTTCCCCACCGGCTTCTGG - Intronic
1098302925 12:69072369-69072391 CTGCCTTCTATTATGGCTTCAGG - Intergenic
1098705699 12:73685692-73685714 CCCACTTCTCTGCTGGCTTCAGG + Intergenic
1100195692 12:92241812-92241834 CTTCCTTGCCCCCTGGCTTCTGG - Intergenic
1101219045 12:102617542-102617564 CTCTCTTCTCTTCTCCCTTCTGG + Intergenic
1101860705 12:108480200-108480222 CTCCCCAGTCCTCTGGCTTCAGG + Intergenic
1102170264 12:110836937-110836959 CTCCCTTACCTTCTGTCTTCTGG - Intergenic
1102196455 12:111028871-111028893 CTCCCTCTTCCTCCTGCTTCAGG - Intergenic
1102625592 12:114233085-114233107 CTCCCTTGCCCTCTGGCTTCAGG + Intergenic
1102767703 12:115448096-115448118 TTCCTTGCTCCTCCGGCTTCTGG - Intergenic
1103080491 12:118020128-118020150 CTCACTTACCCTCTGGCTCCTGG + Intronic
1103764522 12:123271231-123271253 CTCCTTTTTCCTCCGGCTTCTGG - Intronic
1103901938 12:124307880-124307902 CTTCCTGCCTCTCTGGCTTCTGG + Intronic
1103984964 12:124760904-124760926 CTCCATACGCCTCTGGCGTCAGG - Intergenic
1104379156 12:128291758-128291780 TTCCCTTGTTTTCTGGCTTCTGG + Intronic
1104419182 12:128621148-128621170 CTCCCTTGCCCTCTGGCTTCTGG + Intronic
1104498465 12:129262938-129262960 CACCCTTGGTCTCTGGCTTCTGG + Intronic
1104549121 12:129739719-129739741 CTTCCTCATCCTCTGGCTTCTGG + Intronic
1104726383 12:131078077-131078099 CTCCCTCCTCCTGCTGCTTCAGG + Intronic
1105284820 13:18995248-18995270 TTCCCTTGTCTTCTTGCTTCTGG - Intergenic
1105826454 13:24127437-24127459 CTCCCCTACCCTCTGGCCTCTGG - Intronic
1105826712 13:24129586-24129608 TGCCCGTCTCCTCTGACTTCAGG - Intronic
1105844238 13:24281080-24281102 CTCCCTTCTCCTGAGGCGCCAGG + Intronic
1105881471 13:24609863-24609885 ATCCCTGACCCTCTGGCTTCTGG - Intergenic
1106447836 13:29852130-29852152 CTCTCTTCTCTTCTGGCCTTTGG - Intergenic
1106558643 13:30830824-30830846 CTCCCTTCCCCTCTGGTCTCTGG - Intergenic
1107484330 13:40811892-40811914 ATCCCTGGCCCTCTGGCTTCTGG - Intergenic
1108164448 13:47677437-47677459 CTCTCTTGCCCTCTGGCTCCAGG - Intergenic
1108459717 13:50653091-50653113 CTCTCCCCTCCCCTGGCTTCTGG + Intronic
1108749424 13:53432349-53432371 CTCTCTTCTACTCTGTTTTCTGG + Intergenic
1109022786 13:57119444-57119466 CTCTCTTCTCCTCAAGCATCAGG + Intergenic
1109967022 13:69713910-69713932 CTGCTTTCTCCTCTGTCTTGGGG - Intronic
1110292544 13:73824025-73824047 AACTCTCCTCCTCTGGCTTCAGG + Intronic
1111256327 13:85673977-85673999 CTCCCTTCTCCACCAGCCTCTGG - Intergenic
1112239323 13:97665313-97665335 CCTGCTTCTCCTCTAGCTTCTGG - Intergenic
1112598678 13:100833398-100833420 CACGCCTCTCCCCTGGCTTCTGG - Intergenic
1113100433 13:106711764-106711786 CTCCATTTTCCTTTGCCTTCTGG + Intergenic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1113731436 13:112644433-112644455 CATCCCTGTCCTCTGGCTTCAGG + Intergenic
1113804564 13:113105868-113105890 CTGCCTTCTGCTTGGGCTTCAGG + Exonic
1114422809 14:22598591-22598613 CCTCATTCTCCTCTGGCCTCTGG + Intronic
1114705871 14:24726429-24726451 TCCCCTTCCCCTGTGGCTTCAGG - Intergenic
1115480689 14:33858250-33858272 CTTCCTTCTCTTCTGGCACCTGG + Intergenic
1116497126 14:45574730-45574752 CTCTCTTGTCCTCTGGCTCCTGG + Intergenic
1117045573 14:51810087-51810109 CTCTCTTCTCCTCTTCTTTCTGG - Intergenic
1117722270 14:58638807-58638829 TTCCCTCCTCCTCTGCCTTCGGG + Intronic
1119181682 14:72609631-72609653 CACCCTTGTCCTCTGTCCTCTGG - Intergenic
1120346097 14:83292251-83292273 TTCCCTTCTCCTCTGTTTTTTGG + Intergenic
1120516681 14:85479426-85479448 CTCTCATCTCTTCTGGGTTCTGG - Intergenic
1120778628 14:88464988-88465010 CTCCCTCCTCCTCCTGTTTCTGG + Intronic
1121223143 14:92301439-92301461 CTCCCTGCCCCTCTGGCCTCAGG - Intergenic
1121378236 14:93433606-93433628 CTCGTTTCTCCTCTGCATTCAGG + Intronic
1121434319 14:93909060-93909082 CTCAATTCTCCACTGGCTTTTGG + Intergenic
1121555862 14:94836535-94836557 CTCCCCTCCAGTCTGGCTTCAGG + Intergenic
1121612390 14:95290461-95290483 GTCTCTTCTCTTCTGTCTTCTGG - Intronic
1121630948 14:95421639-95421661 TTCCTTTCTCCTCTGGCTGATGG + Intronic
1121638335 14:95468651-95468673 CTCCCTGCTCTTCTGGCCTTGGG + Intronic
1122044111 14:99011235-99011257 CTCCCTGCTCCTCTGCCTTCTGG - Intergenic
1122555028 14:102574090-102574112 CTCACTGCACCTCTGCCTTCTGG + Intergenic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1123404316 15:20011021-20011043 CTCCGTTGTGCTCTGGCTGCTGG + Intergenic
1123513651 15:21017668-21017690 CTCCGTTGTGCTCTGGCTGCTGG + Intergenic
1124422736 15:29536892-29536914 CTCCCCTTTCTCCTGGCTTCTGG - Intronic
1125285757 15:38090804-38090826 CTCCCTTCTCCACTGCTTTGGGG + Intergenic
1125578267 15:40769280-40769302 AGCCCTTCCCCTCTGGCTACCGG - Intronic
1126038388 15:44568460-44568482 CTCATTTCACCTTTGGCTTCTGG - Intronic
1126241475 15:46449667-46449689 CTCCCTTGCCCTCTTGCTTTGGG - Intergenic
1126729813 15:51671412-51671434 CACCCTTGTCCTCTAGTTTCTGG + Intergenic
1126871759 15:52996792-52996814 CTCTCTTGCCCTGTGGCTTCTGG + Intergenic
1127262976 15:57339202-57339224 CTCCCTTCCCCTCCTGATTCTGG - Intergenic
1128345048 15:66848254-66848276 CTCCCTTCTCGCCAGCCTTCAGG + Intergenic
1128455336 15:67828529-67828551 CTCTCTTCTCCTCTTCCTTGGGG - Intronic
1129328165 15:74812887-74812909 CTGCCTTCTCCTCCTGCTCCTGG + Exonic
1129450499 15:75648549-75648571 CTCCTTCCTCCTCTTGCTCCTGG - Exonic
1129580853 15:76808241-76808263 TTACCTGCTCCACTGGCTTCCGG - Intronic
1129583048 15:76832192-76832214 CAGCCTTCTCCTATGTCTTCTGG - Intronic
1129962791 15:79703157-79703179 CTCCCTTCTCCCCTGTTTTGGGG + Intergenic
1130122480 15:81063032-81063054 TTCCTTTCCTCTCTGGCTTCAGG + Intronic
1130146929 15:81281478-81281500 CTGCTTTCTCCTCTGGGTTCCGG + Intronic
1130179708 15:81612785-81612807 CTGCCTCCTTCTCTGGCCTCAGG + Intergenic
1130422732 15:83764442-83764464 CTCCCTTGCCCTCTGGCTTCTGG + Intronic
1130681708 15:86002577-86002599 CTATCTTCTCCACTGGGTTCTGG - Intergenic
1130990507 15:88873113-88873135 GTCCCTTGTCTTCTGGCTGCTGG + Intronic
1131109986 15:89758923-89758945 CTTCCTTCTCCTGGGGCCTCTGG - Intergenic
1131319304 15:91370720-91370742 CTCCATTATGTTCTGGCTTCTGG + Intergenic
1131827385 15:96332061-96332083 CTTCCTGCTCCCCTGGCTGCGGG - Exonic
1131916285 15:97269906-97269928 CCCCACTCTCTTCTGGCTTCTGG + Intergenic
1132200654 15:99952535-99952557 ATTCTTTCTCTTCTGGCTTCAGG + Intergenic
1132710686 16:1265787-1265809 CTCTCTTCTCCTCGGCCCTCTGG - Intergenic
1132807466 16:1781810-1781832 CTCGCTCCTCCTCTGTCGTCCGG + Intronic
1133257141 16:4523948-4523970 GGCCCTTCTCCTCAGGCTTTAGG + Intronic
1133474658 16:6108725-6108747 CTCCTTCCTCTTCTAGCTTCTGG + Intronic
1134883726 16:17771467-17771489 CTATCTTTTCCTCTGACTTCTGG - Intergenic
1135017613 16:18936899-18936921 ATCCCTTGTCCTGTGTCTTCTGG + Intergenic
1135139601 16:19910201-19910223 CTCCCTTCTCCCCTGGAGGCAGG - Intergenic
1136183836 16:28573303-28573325 CTCCCTTCTCCTCTGGCTTCAGG - Intronic
1136581214 16:31152067-31152089 CTCCCTTGAACTCTGGCCTCTGG - Intergenic
1137764883 16:50970360-50970382 CTTCCTTACCCTCTGGCTTCTGG - Intergenic
1138179630 16:54932860-54932882 CGCCCTTGTCCTCGGGCTTCTGG - Exonic
1138203061 16:55104478-55104500 CTCCCTCGCCCTCTAGCTTCTGG + Intergenic
1138491951 16:57382223-57382245 CTGCTTTCGCCTGTGGCTTCGGG - Exonic
1138647503 16:58435810-58435832 ATCCCTTACCCTGTGGCTTCTGG - Intergenic
1140227832 16:73092991-73093013 ATCCCTTCTCCTTTTTCTTCGGG + Intergenic
1140533213 16:75684518-75684540 CTCCCCTCTCCTCTAACTGCTGG - Intronic
1140708199 16:77650930-77650952 AGCCCTATTCCTCTGGCTTCTGG + Intergenic
1140879631 16:79186355-79186377 CTCCTTGCTCCTCTCGCTTCCGG + Intronic
1140955981 16:79865996-79866018 CTCCCTTGGCCTCTTTCTTCTGG + Intergenic
1141154484 16:81587730-81587752 CTCCCTCCTCCCCTGACTTCAGG + Intronic
1141766827 16:86064404-86064426 CTCCCATCTCCCCGGCCTTCGGG + Intergenic
1141889764 16:86918829-86918851 CTCTCTCCTGCACTGGCTTCCGG + Intergenic
1141954309 16:87359981-87360003 CTGCCTGTTTCTCTGGCTTCTGG - Intronic
1141999625 16:87656746-87656768 CGCCTTTCTCCTCTGCCTTGTGG + Intronic
1142172544 16:88630522-88630544 CTCTCTGCCGCTCTGGCTTCGGG - Exonic
1142262394 16:89049076-89049098 CTCCCTTCTCCTTTGACCTGGGG + Intergenic
1143176746 17:4959886-4959908 CTGCCTCCTCCTCTTGCCTCTGG + Exonic
1143392199 17:6566030-6566052 CACTCTTCTCCCCTGCCTTCTGG - Intergenic
1144029035 17:11303652-11303674 CTCCCTTGTCCTCTGTATGCTGG - Intronic
1144233985 17:13238950-13238972 CTCTCTTGTCCTCAGGTTTCTGG - Intergenic
1144430339 17:15185480-15185502 CTCCCTTGACCTGTGGCTTCTGG + Intergenic
1144501258 17:15787760-15787782 CCGCCTGGTCCTCTGGCTTCAGG + Intergenic
1144557445 17:16294691-16294713 CTCCCATGTCCATTGGCTTCTGG + Intronic
1146471815 17:33130817-33130839 CTCCCCTCTCCGCAGGCTTAGGG - Intronic
1146777405 17:35633618-35633640 CTCCCTCTTCCTCTTCCTTCGGG + Intronic
1147140544 17:38458392-38458414 CTCCCTTCTGCTGTGGCCTGGGG + Intronic
1147958501 17:44151454-44151476 TTCCCTTCTCCTTGGGGTTCTGG + Intronic
1148262385 17:46194131-46194153 ATCACTTCCCCTCTGGCTCCCGG - Intronic
1148383903 17:47220939-47220961 CCCCCTTCTCCTCTGGCTGAAGG + Intronic
1148539352 17:48467475-48467497 CTCCCTTGTCATCTGGCTTCTGG + Intergenic
1148698054 17:49572977-49572999 CCCACTTCTCCAGTGGCTTCGGG + Intergenic
1149457767 17:56802198-56802220 CTCCCTTGGCCTGTGGCTTCTGG + Intronic
1149659643 17:58327605-58327627 CTTCCTCATCCTCTGGCCTCTGG + Exonic
1151001919 17:70386704-70386726 CTCCTTTCTGCTCTTGCTCCAGG - Intergenic
1151401858 17:73861007-73861029 CTCCCTGTTCTTCTGCCTTCTGG - Intergenic
1151572001 17:74931086-74931108 CTGGCGTCTCCACTGGCTTCTGG - Exonic
1151577641 17:74960736-74960758 CTCCCTTCTCTTCTGGAGTAGGG + Intronic
1151838237 17:76598389-76598411 CTTCCTTCTGCTCTGGCTTGGGG - Intergenic
1152224280 17:79085529-79085551 CTCCCTTCTGCTGTGGCTTGGGG + Intronic
1152288254 17:79424648-79424670 CTCCTCTCCCCTCTGGCCTCAGG + Intronic
1152293194 17:79452515-79452537 GTCCCCTGCCCTCTGGCTTCTGG + Intronic
1152466541 17:80469825-80469847 CACCCCTCTCCTTTGGCCTCCGG - Exonic
1152681437 17:81670391-81670413 CTGCCTGCACCTCTGGCTGCCGG - Exonic
1152795791 17:82305517-82305539 CTGCCGTCTCCTCTGGCATCAGG + Intergenic
1153766615 18:8380791-8380813 TTCCCTTCTCCACTGTCCTCTGG - Intronic
1155341636 18:24819451-24819473 CCCCCTTCTCATATGGCCTCAGG + Intergenic
1155454646 18:25998157-25998179 CACTCTTCTCCACTGGCTTCTGG - Intergenic
1155858128 18:30860897-30860919 CTCACATCTCCTGTGCCTTCAGG + Intergenic
1156635990 18:39030159-39030181 CTCCTTTCTCCTCAGGCCTGGGG - Intergenic
1157807122 18:50666374-50666396 CTGTCTGCTCCTCTGGCTTATGG + Intronic
1158045691 18:53152972-53152994 CTCTTTTCTCCTTAGGCTTCAGG - Intronic
1158228662 18:55229036-55229058 CTGCCTTCTGCTCTGGTGTCAGG + Exonic
1158417146 18:57258461-57258483 CACCTTCCTCCTCTGGCATCTGG - Intergenic
1158557503 18:58487351-58487373 CATGCCTCTCCTCTGGCTTCCGG - Intronic
1158629018 18:59096001-59096023 CTTGCCTCTCCCCTGGCTTCTGG - Intergenic
1159339597 18:67118466-67118488 CTCCTTGCTCTTCTGGCATCCGG - Intergenic
1159889892 18:73943468-73943490 CTGCCTTCCCCTCTGGCTCCGGG - Intergenic
1160456438 18:79005716-79005738 TTCCCCTCACCTGTGGCTTCAGG - Intergenic
1161015457 19:1980750-1980772 CTGCCTTCCCCTTTGGTTTCGGG - Exonic
1161136268 19:2621815-2621837 CTTCCGCGTCCTCTGGCTTCTGG - Intronic
1162003639 19:7763785-7763807 CTCCCACCTCCTCTGGTTCCAGG - Intronic
1162009585 19:7804189-7804211 CTCCCTTCACCATTGGCCTCAGG + Intergenic
1162071002 19:8151959-8151981 CTTCCTTCTCCCCTCTCTTCTGG - Intronic
1162453676 19:10769595-10769617 CTCAGTTCTCTTCTGGCTCCAGG - Intronic
1162474817 19:10893664-10893686 CTGCCTTCACCCCTGGCCTCAGG - Intronic
1163048449 19:14662743-14662765 CTCCCTTTTGCTCCTGCTTCTGG + Intronic
1163349033 19:16763809-16763831 CTCCCTTCTCCTCTGCCAGGTGG + Exonic
1164834643 19:31349562-31349584 CCCCCTCCTCCTCTGGCCTCTGG - Intergenic
1164952515 19:32349253-32349275 CTCCCCTGTCCTCTGCCTTCTGG - Intronic
1165002468 19:32776313-32776335 CTCCCAGTTCCTCTGGCTTCAGG + Intronic
1165261546 19:34623462-34623484 CTCCCATCTCCTCTGGGTCCTGG + Intronic
1165372020 19:35414529-35414551 CTCCCTTGTCCTCTGCCATGTGG + Intergenic
1166193350 19:41190586-41190608 ACCCCTCCTCCTTTGGCTTCAGG + Intergenic
1166295536 19:41887675-41887697 CTCCCATCCCCTCTTGCCTCTGG + Intronic
1166344694 19:42157856-42157878 CCCCCTCCTCCTCTCCCTTCTGG - Intronic
1167383389 19:49150850-49150872 TCCCCTTCTCCTCTGGCTCCGGG + Exonic
1167387255 19:49171335-49171357 CCCCCTTCTCTTCTTGCCTCAGG + Exonic
1167682430 19:50932246-50932268 CTCCCTGCTCCTCAGCCTCCTGG + Intergenic
1167713827 19:51128106-51128128 GTCCCTCCAGCTCTGGCTTCAGG - Intronic
1167722377 19:51187329-51187351 GTCCCTCCAGCTCTGGCTTCAGG - Intergenic
1167879881 19:52447958-52447980 GTCCCTCCTCTTCTGCCTTCTGG + Intronic
1167896435 19:52585780-52585802 CACCCATCTGCTCTGGCCTCAGG - Exonic
1167920216 19:52777301-52777323 CTCCCTGCCCCTCTGCCTTCTGG - Intronic
1168246665 19:55116048-55116070 CCCCGTTCTCCTGTGGATTCGGG - Intronic
1168590678 19:57632093-57632115 TTCCCTTGTCCGTTGGCTTCAGG + Intronic
1202699059 1_KI270712v1_random:149431-149453 TTTCCTCCTCCTCTGGCTTTTGG + Intergenic
924977801 2:193795-193817 CGACCTTCTCCTCAGGCTTATGG - Intergenic
925368295 2:3325843-3325865 CACCCTTATCCTGTGGCTTCAGG + Intronic
925607305 2:5672680-5672702 CCCTTTTCTGCTCTGGCTTCTGG + Intergenic
925818519 2:7776866-7776888 TTCATTTCTCCTCTGGCTTCTGG + Intergenic
926419520 2:12682802-12682824 CTCCCCTCTCAGCTGGCTTTGGG + Intergenic
926584076 2:14666073-14666095 CTCCTTTGCTCTCTGGCTTCTGG + Intergenic
927065118 2:19463271-19463293 CTTCCTTGACCTCTGGCTACTGG - Intergenic
927304160 2:21551115-21551137 CTCCCTTCTTCCCTTCCTTCAGG + Intergenic
927392970 2:22616252-22616274 CTCCCTTGCCCTCTGACTCCAGG - Intergenic
927872365 2:26631749-26631771 CTCCCTTTCCCTCTGGCTTAAGG + Intronic
927929712 2:27036408-27036430 CTCCCTTCCCTCCTGGCTTTGGG + Intronic
928230583 2:29495253-29495275 CTCCCTGGCTCTCTGGCTTCTGG + Intronic
928890700 2:36199815-36199837 ATCACTTGTCCTCTGGTTTCTGG + Intergenic
929100394 2:38306348-38306370 TTCCCTCCTCCTCTGGTTTTTGG - Intronic
929404011 2:41620235-41620257 CTTCATTCTTCTCTGCCTTCTGG - Intergenic
929537328 2:42792018-42792040 CCCCCTTTGCCTGTGGCTTCTGG + Intronic
929917547 2:46148560-46148582 CTCCCTTCTCTTCTAGCCTCAGG - Intronic
930068362 2:47345131-47345153 CTCCCCTCTCCTTTGTCTCCAGG - Intergenic
930320792 2:49852590-49852612 CTCCCTTCTTCTCTACCTTCTGG + Intergenic
930425880 2:51211789-51211811 CTTCCTTGTCAACTGGCTTCTGG - Intergenic
930747583 2:54900720-54900742 CTCCCTTGTCCTCTGGTTTCAGG - Intronic
931426592 2:62177316-62177338 CTTCCCTGTCCTCTGACTTCTGG - Intergenic
932633386 2:73366518-73366540 CTCCCTTGTCCCCTGCCCTCTGG - Intergenic
932813335 2:74842662-74842684 CATCCTTCTTCCCTGGCTTCAGG - Intronic
932835414 2:75031315-75031337 CTCCCTTGCTTTCTGGCTTCTGG + Intergenic
933105431 2:78318779-78318801 CTCCCTTGTCGTCTGGCTGCTGG + Intergenic
933793383 2:85901713-85901735 TTCTCTTGTCTTCTGGCTTCGGG + Intergenic
934170009 2:89532912-89532934 TTTCCTCCTCCTCTGGCTTTTGG + Intergenic
934280311 2:91607220-91607242 TTTCCTCCTCCTCTGGCTTTTGG + Intergenic
934486705 2:94721367-94721389 CTCCCTCACCCTCTGGCTTTAGG - Intergenic
934965767 2:98720466-98720488 CTCCCTTATCCTCAGGCCTTTGG + Intronic
935314332 2:101816634-101816656 CTACCTTCTCCTTTTGCTCCGGG + Intronic
935326024 2:101937475-101937497 CTCCACTCTCTTCTGGCTTATGG - Intergenic
935605596 2:104969662-104969684 ATCCATTGTTCTCTGGCTTCTGG + Intergenic
935682091 2:105647045-105647067 CTCCCTCCTCCTCGGGCTTCTGG + Intergenic
936434927 2:112496131-112496153 ATCCCTTCTCCTGTGGGTTTGGG + Intronic
936508124 2:113124365-113124387 CTCCCTCTTCCTCACGCTTCTGG - Intronic
936633716 2:114232685-114232707 CTCCCTCTTTCTCTAGCTTCTGG + Intergenic
936969071 2:118158218-118158240 TTCCCTTCTCTTCTGGCTGCAGG - Intergenic
937228647 2:120384193-120384215 CTCCCTTCTCCCCTTTCTTGAGG + Intergenic
937358051 2:121210864-121210886 CTCCCTTCACCGCTGCTTTCAGG + Intergenic
937881046 2:126865081-126865103 TTCCCTTTTCCTTTAGCTTCAGG - Intergenic
938036426 2:128038602-128038624 TTCCCTTCCCCTCTGCCTTAGGG + Intergenic
938585925 2:132690698-132690720 CTCCCTTTATTTCTGGCTTCTGG + Intronic
938730565 2:134143816-134143838 CTGCCTTCTCTTCTGCATTCAGG - Intronic
938769904 2:134492511-134492533 CTCCCTCCACCTCTAGCCTCAGG + Intronic
938928318 2:136064302-136064324 CTTCCTTGACCTCTGGCTTCTGG - Intergenic
939114756 2:138047864-138047886 CTCACTTCTGCACTGGCTTTAGG + Intergenic
939196672 2:138981323-138981345 CTCTCTTGCCTTCTGGCTTCTGG - Intergenic
939215840 2:139237172-139237194 CTTCCTTCCCCTCTGGCTTCTGG - Intergenic
939559709 2:143718004-143718026 CTGCTTTCTCCTCTGCATTCTGG - Intronic
939617543 2:144378001-144378023 CACCCTTTTCCTTTGCCTTCTGG + Intergenic
940810371 2:158235995-158236017 CTTCCTTGCCCTCTGGCTTTTGG - Intronic
941085890 2:161117843-161117865 CTCTCTTCTCTTATGGCCTCAGG + Intergenic
941099870 2:161283729-161283751 CTTCCTTGCCTTCTGGCTTCTGG + Intergenic
941316058 2:163994046-163994068 CTCCCTTGTCCTCTGAATTCTGG - Intergenic
941339157 2:164284663-164284685 CTCCCTTCCCCTCTACCCTCTGG - Intergenic
941767316 2:169312530-169312552 CCCCCCTCTCTTCTGGCTTGTGG + Intronic
941917894 2:170823906-170823928 TCCCCTGCTCCTCTGGCTGCAGG + Intronic
941926668 2:170902444-170902466 CTCCCTTTATCTCTGGCTTCTGG + Intergenic
942528260 2:176879666-176879688 GGCCCTTCTCCCCTCGCTTCAGG + Intergenic
944432378 2:199647096-199647118 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
945286284 2:208085941-208085963 CTCTCTTCTCCTTTAGCTTCTGG + Intergenic
945474469 2:210264849-210264871 CTCCCTTGTCCCTTGGCTTCTGG + Intergenic
945691631 2:213044034-213044056 CTCCGTTGTCCTCTGGCTTCTGG + Intronic
945803794 2:214465531-214465553 CTCCCTTCTCCTCTAGTTGAAGG + Intronic
945988162 2:216371437-216371459 CGCCCTCCTCCTCCGGCTCCGGG + Exonic
946028943 2:216690304-216690326 TTCCCTTCTGCTCTGGCCCCTGG + Intronic
946045677 2:216819020-216819042 CTTCCTTGCCCTCTGGCTTCTGG - Intergenic
946120775 2:217512125-217512147 CTCCATGCTCCTCTGGGCTCAGG + Intronic
946341291 2:219071031-219071053 TTCCCTTCTCATGTGGCATCAGG + Intergenic
946414795 2:219534575-219534597 CTCCCTTGTCCTCTGGCTTTGGG - Intronic
946496681 2:220202520-220202542 CTGGCATCTCCTCTGGCCTCAGG + Intergenic
946532686 2:220589322-220589344 CTTCCTTCTCTCTTGGCTTCTGG - Intergenic
946569330 2:221004541-221004563 TGCCCTTGCCCTCTGGCTTCTGG - Intergenic
947164179 2:227244929-227244951 CTCCTTTTTCCTATGTCTTCAGG + Exonic
947618831 2:231575866-231575888 CTCCCTCCTGCTCTGGGTGCTGG - Intergenic
947663527 2:231888099-231888121 CCCCCAGGTCCTCTGGCTTCTGG + Intergenic
947698141 2:232210076-232210098 CTCACATCTCTTCTGGCTTGGGG + Intronic
947854576 2:233314452-233314474 TTCCCTGGTCTTCTGGCTTCTGG - Intronic
948083321 2:235225586-235225608 CTCCCTTCAGCTCTAGTTTCAGG + Intergenic
948288223 2:236803801-236803823 CTCCTTTACCCTCTGGCTTCGGG + Intergenic
948613194 2:239182400-239182422 CTCACTTTCCCTCTGGGTTCTGG - Intronic
948671369 2:239570819-239570841 CTCATTTATCCTCTGGCTCCAGG - Intergenic
948964518 2:241367180-241367202 CACCCTTCTCCCCAAGCTTCTGG + Intronic
948976817 2:241468535-241468557 TTCCCGTCTCCTCTGGCTGCTGG + Intronic
1169265982 20:4167691-4167713 CTCCCTCCTCTTCTGTCTCCTGG + Intronic
1169512022 20:6274773-6274795 TGGGCTTCTCCTCTGGCTTCTGG + Intergenic
1170929420 20:20755338-20755360 GTTCCTTCTCATCTGGCTTTAGG + Intergenic
1170930508 20:20766020-20766042 CCGCCTTCTCCTCTAGTTTCTGG - Intergenic
1171283234 20:23918636-23918658 CTGCCTTCTCTTTTGGCTCCTGG + Intergenic
1171879354 20:30605658-30605680 CTCACTTCTCCTTTGTCTTCAGG + Intergenic
1172014861 20:31867284-31867306 CTCCCTGATCCTCTTGCTTCTGG + Intronic
1172482440 20:35278761-35278783 TTCCCTTCTCCTCTACCATCAGG - Intergenic
1172828213 20:37808357-37808379 CTCCCTTCTTTTCTGACTGCAGG - Intronic
1173158185 20:40632590-40632612 GTCCCTTGTCCTCCGGCATCAGG + Intergenic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1175834629 20:61985718-61985740 CTCACTTCTCCTCAGGCCTCAGG - Intronic
1176258603 20:64166993-64167015 CTCCCTTCCTCTCTGGCCTGGGG + Intronic
1176259391 20:64171652-64171674 CTCCCTACACCTCTGGCATCTGG + Intronic
1176259412 20:64171730-64171752 CTCCCTACACCTCTGGCATCTGG + Intronic
1176259444 20:64171846-64171868 CCCCCTACACCTCTGGCATCTGG + Intronic
1176259456 20:64171886-64171908 CCCCCTACACCTCTGGCATCTGG + Intronic
1177967755 21:27749476-27749498 CTCTCTTGTTCTCTGGCATCTGG - Intergenic
1178163622 21:29946917-29946939 CTTCCTTCTCATTCGGCTTCAGG + Intergenic
1178175222 21:30089392-30089414 CTACCTTATCTTCTGGATTCTGG + Intergenic
1178964529 21:37103812-37103834 CTACCCTCTCCTCTGTATTCAGG - Intronic
1179230536 21:39500123-39500145 CTCCCTCCTGGTCTGGGTTCAGG - Intronic
1179455143 21:41494226-41494248 GACCCTTCTCCTCCGTCTTCCGG - Intronic
1180168068 21:46040359-46040381 CTCACTTCACCTCTGGCACCAGG + Intergenic
1180305330 22:11068398-11068420 CCCCCTTCTCCTGTGGTCTCTGG + Intergenic
1181117587 22:20642683-20642705 CTCCCTCCTTCTCTGCCTGCAGG - Intergenic
1181589866 22:23877464-23877486 CTGCCTTCTCCTCTTTTTTCTGG - Intronic
1182228285 22:28817052-28817074 CTCTCTCCTCTTCTGGATTCTGG - Intergenic
1182437340 22:30339126-30339148 GCACCTTTTCCTCTGGCTTCTGG + Exonic
1182508237 22:30800751-30800773 CTCCATTCTTTTCTGGGTTCTGG - Intronic
1182572329 22:31248602-31248624 CTCCCGGCACCTCTGGCTGCAGG - Exonic
1182652218 22:31861346-31861368 CTTCCTCCTCCTGTGACTTCAGG + Exonic
1183935609 22:41260388-41260410 CTCCCTGCACCCCTGGCTGCAGG - Intronic
1184252413 22:43268235-43268257 CTCCGTCCTCCTGTGGCTCCCGG + Intronic
1184336779 22:43858459-43858481 ATCCCTTCCCCTTTGTCTTCCGG - Intronic
1184657169 22:45947667-45947689 TCCCCTTCTTCCCTGGCTTCTGG - Intronic
1184688477 22:46106921-46106943 CTGACCTCTCCTCTGGCCTCAGG - Intronic
1185189836 22:49428117-49428139 CTCCCTTCACCACTGGCTCAGGG + Intronic
1185364675 22:50432003-50432025 CTCCCTTCTCCTCCAACTCCTGG - Intronic
1185383001 22:50518722-50518744 CTCTCTTCTCACCTGGCTCCTGG - Exonic
949437258 3:4042990-4043012 CTCCTGTCTCCTCTGACTTCAGG + Intronic
949536047 3:4996997-4997019 CTAGCTTCTCCTCTGTCTTAAGG - Intergenic
949875036 3:8621037-8621059 CTCCCATCTGTACTGGCTTCTGG + Intronic
950707355 3:14791382-14791404 CTCCCTTGTCCTCTGGGATGTGG + Intergenic
950798989 3:15534091-15534113 CTCTCCTCAGCTCTGGCTTCAGG + Intergenic
951472547 3:23071680-23071702 CTTCCTTCTCCTCTTGCTTCTGG - Intergenic
952225168 3:31367578-31367600 CTCCCTTGCCCTCTAGGTTCTGG - Intergenic
952354819 3:32574281-32574303 GTCTCTTGTCCTCTGGCTCCTGG - Intergenic
952721717 3:36540611-36540633 CACCCTCATCCTCTGGCTTGTGG - Intronic
953194730 3:40721688-40721710 CTTCCTTGCTCTCTGGCTTCTGG + Intergenic
953582724 3:44171926-44171948 CTGCCTTGCCCTCTGGCTTCTGG + Intergenic
953706739 3:45236991-45237013 ATCCCTTCTCCACTTTCTTCTGG + Intergenic
954326081 3:49864810-49864832 CTCCCTTCTCCACTACCTTGAGG - Intronic
954486112 3:50853184-50853206 CTCCCTTCCCTTCCAGCTTCTGG + Intronic
954951427 3:54477690-54477712 CTGGCTTGTCCTCTGGCTCCAGG + Intronic
955370232 3:58344890-58344912 CTCCCTTCAGGTCTGGCCTCCGG - Intronic
955378855 3:58421080-58421102 CCACCTTCTCCTTTGGCTTCAGG - Intronic
955470303 3:59279686-59279708 TTCCCTTCTCTACTTGCTTCCGG + Intergenic
955878766 3:63521932-63521954 CTCTTTTGTCCTCTGGTTTCTGG - Intronic
956821094 3:72954917-72954939 CTTCCTTCTCCTTTGACTTGAGG - Intronic
957149583 3:76468730-76468752 CTCCCATGTCCTCTCTCTTCAGG + Intronic
958743045 3:98097956-98097978 CTCCCTTCTCTTCTGGATCTTGG + Intergenic
958923368 3:100130959-100130981 CTCTCTCCTCCTTTGTCTTCTGG - Intronic
959139723 3:102471174-102471196 CTCCCTTGCCCTCTAGTTTCTGG + Intronic
959459668 3:106609710-106609732 GTCACTTCTCCTCTTTCTTCTGG + Intergenic
961167921 3:124776339-124776361 CTCCCTCACCCTCTGGCCTCAGG + Intronic
961344715 3:126256530-126256552 TTCCCTTCTCCTCTGGCCCCAGG - Intergenic
961397044 3:126601319-126601341 CTCCATTCTCCTTTTTCTTCTGG + Intronic
961401058 3:126643203-126643225 CAGCCTTGCCCTCTGGCTTCTGG - Intronic
961591029 3:127982111-127982133 TTCCTTTCCTCTCTGGCTTCTGG + Intronic
962037128 3:131663848-131663870 CTCCCTTCTACTTTGACTTTGGG + Intronic
962042776 3:131724517-131724539 CACCCTTGCCCTCTGGGTTCTGG + Intronic
962263296 3:133928372-133928394 CTCTCTTCTCATCTGGGTGCTGG - Exonic
962748956 3:138418607-138418629 TTCCCTTCTTCTGTGGCTGCAGG + Intergenic
962957185 3:140276903-140276925 CTCCCTGCTTCTCTGCCTACAGG - Intronic
963120179 3:141769672-141769694 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
963465693 3:145678577-145678599 CTCCCTTGTCCTCTGGCATCTGG - Intergenic
963798838 3:149657696-149657718 CTCCAGGCTCCTCGGGCTTCCGG - Intronic
963862844 3:150328640-150328662 CTCCCTTCTCCTCTTGTACCTGG - Intergenic
964605160 3:158553114-158553136 TTCCCTTGCCCTCTGGCTTCTGG + Intergenic
964766257 3:160180967-160180989 CTCCCTTCCCATCCGGCCTCAGG + Intergenic
966896834 3:184451423-184451445 CTCACTTCACCTCTGCCTTCTGG + Intronic
966898119 3:184461052-184461074 CTCCCTCCTCCTCTGTGTTGGGG + Intronic
968448486 4:664092-664114 CTCCCTTGTTCCCTGGGTTCAGG + Exonic
968640320 4:1711529-1711551 CTCACTTCTCCTCGGGACTCGGG + Intronic
968877755 4:3282985-3283007 CTCCCTTTCCTTCTGGCTTCTGG + Intergenic
969332779 4:6489377-6489399 CTCCCTCCACATCGGGCTTCAGG + Intronic
969351040 4:6598076-6598098 CCCCCTTCTCCACTGGCACCTGG + Intronic
969417911 4:7073170-7073192 CTCCCTTCACCTCTGCCCACCGG - Intergenic
969600853 4:8175437-8175459 CTCCCTTCCCCTATGGCCCCCGG - Intergenic
970626859 4:17895700-17895722 CTCCCTTGTCCTATGACTCCTGG + Intronic
972240559 4:37187388-37187410 CTTCCTTTTCCTCTGGATTCTGG - Intergenic
972367465 4:38389939-38389961 CTTCATTGTCCTCTGGCTTCTGG - Intergenic
973344186 4:49036707-49036729 GTCCCTTGCCTTCTGGCTTCTGG + Intronic
974769974 4:66400316-66400338 GTCACTTCTCCCCTAGCTTCAGG - Intergenic
975469334 4:74747274-74747296 CTCCATTGCCCTCTGGTTTCTGG + Intronic
975749517 4:77508429-77508451 CTCCCTTGACCAGTGGCTTCTGG - Intergenic
976441911 4:85085596-85085618 CTCCCTTGCCCTCCGGCTTCTGG - Intergenic
976494915 4:85716968-85716990 CTCTCTTGATCTCTGGCTTCAGG - Intronic
976507568 4:85866719-85866741 CTCCCTTCCCCTGTGCCTTTTGG + Intronic
977143060 4:93399792-93399814 CTCCCATAACCTCTGACTTCTGG - Intronic
977503769 4:97877225-97877247 CTCCCTTTTCCCCTAGCTTCTGG + Intronic
977716303 4:100187764-100187786 GTCGCTTCTCCTCTGGTTTCAGG - Exonic
978043335 4:104096252-104096274 ATCCCTTCTCCTCTACTTTCTGG - Intergenic
978486144 4:109255665-109255687 CTCACTTTTCTTCTGGCTTAGGG - Intronic
979280609 4:118863192-118863214 CTCCCTTCTCCTCTATTTTTCGG + Intronic
979413757 4:120410806-120410828 CTCCCTTCTCCTCTATTTTTTGG - Intergenic
979514179 4:121588075-121588097 CTCACCACTCTTCTGGCTTCTGG + Intergenic
979520975 4:121666080-121666102 ATCTTTTCTCCTATGGCTTCTGG + Intergenic
980944412 4:139304846-139304868 CTCCCATCCCCTCTCGCTGCAGG + Intronic
982078309 4:151761129-151761151 CTCCCCTCTCCGCGGGGTTCCGG - Intergenic
982330533 4:154177436-154177458 CTTTCTTGCCCTCTGGCTTCTGG + Intergenic
982454651 4:155594377-155594399 CTGCCTTGCCCTCTGACTTCTGG - Intergenic
982961294 4:161840826-161840848 CTGCCTTTTCGTCTGACTTCTGG + Intronic
983886479 4:172985962-172985984 CTCCCCTCTCCTCTTGATTAGGG - Intronic
985282443 4:188300727-188300749 CTCCCTCCTACTCTAGCTTTTGG + Intergenic
985382816 4:189413548-189413570 CTCCCTTGCCTTCTGGCTTTTGG + Intergenic
985522413 5:382199-382221 TTCCCTTCTCTTCTGTTTTCTGG + Intronic
985894026 5:2738731-2738753 CTCCCTCCTCCTGTGCCTCCGGG + Intergenic
986167502 5:5288059-5288081 CTCCTTCCTCCTCTAGTTTCGGG - Intronic
986338611 5:6772444-6772466 TTCCTTGCTTCTCTGGCTTCTGG + Intergenic
986386788 5:7242728-7242750 AGCCCTTCTGCTCTGCCTTCCGG + Intergenic
986424256 5:7614667-7614689 CTCCTTTGCCCTCTGGCTTCAGG + Intronic
986485591 5:8232977-8232999 CTGCCCTCTCCTCTTCCTTCTGG - Intergenic
987048824 5:14132319-14132341 CTCCCTTCCTCTCTGACTCCCGG + Intergenic
987092937 5:14523478-14523500 CTCTCCTGTCCTCTGGCTTTTGG - Intronic
987253818 5:16127827-16127849 CTGCCCGCCCCTCTGGCTTCTGG + Intronic
987276701 5:16370685-16370707 GTCTCTTGTCCTCTGGCTTCTGG - Intergenic
990039465 5:51361813-51361835 TTCTCTTTTCCCCTGGCTTCTGG - Intergenic
990328693 5:54703823-54703845 CTCCTTTGTCCCCTGGCTTCTGG - Intergenic
990737744 5:58882049-58882071 CTCCCTGGTCCTCTAGATTCTGG + Intergenic
990954288 5:61328561-61328583 CTCACTTCTCCCTTGGCTCCTGG + Intergenic
990983178 5:61619707-61619729 CTCCCTTGCCCTCTGGCTTCTGG - Intergenic
991246518 5:64514049-64514071 CATGCTTCTCCTCTAGCTTCTGG + Intronic
991309527 5:65221106-65221128 TTCCTTTCTCCTCTGTTTTCTGG - Intronic
992015161 5:72567991-72568013 CTCCCTTGCCAACTGGCTTCTGG + Intergenic
992368515 5:76118166-76118188 CTCCTTGCTCTTCTAGCTTCTGG + Intronic
993013485 5:82510063-82510085 CTCCCTTGCCTTCTGGCTTCTGG - Intergenic
994665836 5:102704380-102704402 CTCCCTTCTCCCCTAACTTCAGG - Intergenic
995012884 5:107277544-107277566 CTCCCTCGTCTTCTGGCCTCAGG - Intergenic
995227023 5:109711996-109712018 CTCCTTTCTTCTCTAGCATCAGG + Intronic
995797907 5:115961697-115961719 GTCCCCTCTCCCCCGGCTTCAGG + Intergenic
996318881 5:122191820-122191842 CTCCCGTCTGCTTTGGCTGCAGG - Intergenic
996330688 5:122325247-122325269 CTCCCTTGTTCTCTGGCTTCCGG + Intronic
996447367 5:123571105-123571127 GTCCCATCTCCTCTTGCTACTGG - Intronic
997188297 5:131903465-131903487 CCCCATTCTCTTCTGGCTTATGG - Intronic
997337903 5:133120734-133120756 CTTCCTTCTCCCCTGGACTCCGG + Intergenic
997353708 5:133248868-133248890 CTACCTTCTCATCTGGCACCTGG + Intronic
997600494 5:135135246-135135268 CTCAGTTCTGCTGTGGCTTCAGG + Intronic
997675981 5:135713828-135713850 CTCCCTCCTGCACTGGCTGCAGG + Intergenic
997950755 5:138241035-138241057 CTCCCTTGTCAGCTGGCTTTTGG - Intergenic
998334041 5:141355248-141355270 CTGCCTTCTCCTGGGGGTTCTGG + Exonic
998366000 5:141631941-141631963 CTCCTTTCCCCTATGTCTTCTGG - Intronic
998504483 5:142660908-142660930 CTCCTTCCTTCTCTGGCTCCAGG + Intronic
999913225 5:156229150-156229172 CTCCCTGCTCCTCAGCCTGCAGG + Intronic
1000156933 5:158561542-158561564 GTCCCCTCTTCACTGGCTTCTGG + Intergenic
1000410206 5:160929549-160929571 CACCCTCCTCCCTTGGCTTCTGG + Intergenic
1000955809 5:167542189-167542211 CTTCCTTCTCTTCTGGCTTTTGG - Intronic
1001312564 5:170621863-170621885 CTCTCTTCTCCTCTCATTTCTGG - Intronic
1001436693 5:171704787-171704809 CTCCCTTCTGTTTTGGCTTTGGG + Intergenic
1001679267 5:173544295-173544317 CCCCCATGGCCTCTGGCTTCTGG + Intergenic
1002449304 5:179309960-179309982 CACCCCTGCCCTCTGGCTTCTGG + Intronic
1002637397 5:180615160-180615182 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637409 5:180615205-180615227 CTCCCTTCTCCACTTCCTTTTGG + Intronic
1002637435 5:180615308-180615330 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637460 5:180615411-180615433 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637487 5:180615514-180615536 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637499 5:180615558-180615580 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637510 5:180615603-180615625 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637522 5:180615647-180615669 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637547 5:180615748-180615770 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637560 5:180615793-180615815 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637571 5:180615837-180615859 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637582 5:180615881-180615903 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637595 5:180615926-180615948 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637608 5:180615971-180615993 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637619 5:180616015-180616037 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637630 5:180616059-180616081 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002637641 5:180616103-180616125 CTCCCTTCTCCACTTCCTTTCGG + Intronic
1002773302 6:307572-307594 CTGCCTTCCCTCCTGGCTTCTGG - Intronic
1002795007 6:465246-465268 CAGCCTTCACCTCTGTCTTCAGG - Intergenic
1003361376 6:5429384-5429406 CTGCCTTCTCCTGTGGAATCTGG + Intronic
1003484026 6:6559940-6559962 TTCCCTTCTCTTCTGTTTTCTGG + Intergenic
1003840055 6:10111032-10111054 CTCCCTTGTCCTCTGGCTGCTGG + Intronic
1004064416 6:12228861-12228883 CTCCCTCCTCCCAAGGCTTCTGG - Intergenic
1004140507 6:13013668-13013690 CTACCCCCTCCTCCGGCTTCGGG + Intronic
1004163397 6:13234144-13234166 CTTCATTCTGCCCTGGCTTCAGG - Intronic
1004780611 6:18904418-18904440 TTCTTTTATCCTCTGGCTTCTGG + Intergenic
1005016890 6:21383089-21383111 CAGGCTTCTCCCCTGGCTTCCGG + Intergenic
1005415655 6:25597921-25597943 CTCCATTATCTTCTAGCTTCCGG + Intronic
1005617282 6:27586115-27586137 CTCCCTTGTCAACTGACTTCTGG - Intergenic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1006169059 6:32082598-32082620 CTCCCTGCTGCTCTGGTTTGTGG - Intronic
1006226485 6:32541972-32541994 TTCCCTTCTCTTCTGCTTTCTGG + Intergenic
1006271389 6:32969342-32969364 ATCCCTTCTCACCTGGCTCCCGG - Intronic
1006305132 6:33214058-33214080 CTGACTTCTCTTCTGGCTCCAGG + Intergenic
1006854441 6:37123419-37123441 CCCTGTCCTCCTCTGGCTTCTGG - Intergenic
1006944683 6:37777575-37777597 CTCCCCGCTCCTCCAGCTTCAGG - Intergenic
1007132110 6:39484930-39484952 CTGCCCTCTCCTCTGGATTCTGG + Intronic
1007408516 6:41648498-41648520 CTCCCCTCTCCTTGGGCTCCAGG + Intronic
1007781486 6:44257257-44257279 CTCCCATCCCCGCTGGCTCCGGG + Intronic
1007870723 6:45034331-45034353 CTCTCTTGCCCTCTGACTTCTGG - Intronic
1008154224 6:47994143-47994165 ATCCCTTGTCCTCTGGCTTTTGG - Intronic
1008487091 6:52048089-52048111 CTCCTGCCTCTTCTGGCTTCTGG - Intronic
1009349151 6:62652794-62652816 CTCCTGTCTCCTCTGGGTCCCGG + Intergenic
1009398655 6:63229877-63229899 CTGCCCTCACCTCTGTCTTCGGG + Intergenic
1009417803 6:63434775-63434797 CTGTCTTCCCCTCTGGTTTCAGG - Intergenic
1010287390 6:74094891-74094913 GTCCCTCATCCTTTGGCTTCTGG - Intergenic
1010505112 6:76647592-76647614 CTTTCTTGTCCTCTAGCTTCTGG - Intergenic
1012314914 6:97774060-97774082 CTCACTGCACCTCTGCCTTCTGG + Intergenic
1013261595 6:108449371-108449393 CTGCCTTCTCCTCTGACTGAGGG - Intronic
1013479694 6:110543189-110543211 CCCCATTGCCCTCTGGCTTCTGG - Intergenic
1014974047 6:127856493-127856515 CTCGCTTGTCCTCTGGCTTCTGG - Intronic
1015547521 6:134376719-134376741 CTCACTTGCCCTCTGGTTTCTGG + Intergenic
1015629728 6:135219689-135219711 CTCCCTTGTCCTCCAGCTTCTGG - Intergenic
1015680075 6:135797273-135797295 CTCCCATCTTCTCTGGCTTTTGG - Intergenic
1016095380 6:140030864-140030886 TTCCCTCCTCCTTTGGATTCAGG + Intergenic
1016547691 6:145242611-145242633 TTCCCTTCTTCTCTGGGTCCAGG - Intergenic
1017291642 6:152744733-152744755 CACCCTGGTCCTCTGGCTGCTGG - Intergenic
1018316999 6:162566742-162566764 TTCCCTCCTCCTCTGTCTTTTGG - Intronic
1018435344 6:163753946-163753968 CAGGCCTCTCCTCTGGCTTCTGG + Intergenic
1018581221 6:165309717-165309739 CTCCCCTCTTCTGTGCCTTCTGG + Intergenic
1018647339 6:165960848-165960870 CTCCCTGCCCATCTGTCTTCTGG - Intronic
1018836450 6:167487825-167487847 CTCCCTTCTCCTCCCGCCGCAGG + Intergenic
1018903517 6:168062817-168062839 CTCCCTTCCCCACTGGAGTCTGG - Intronic
1019167541 6:170108613-170108635 GCCCCTGCACCTCTGGCTTCAGG + Intergenic
1019361303 7:605431-605453 CTCCCATCTCTTCTGCCGTCCGG - Intronic
1019606169 7:1911311-1911333 CTCCCTCCTCCTCAGGCCCCAGG + Intronic
1020275430 7:6621924-6621946 CTTCCTCCTCCTCGGGCTCCAGG - Exonic
1021197597 7:17690379-17690401 CTCTTCTCTCCTCTGGGTTCAGG + Intergenic
1021609785 7:22445684-22445706 CTCCCTGCTGCTCTTGCATCTGG - Intronic
1022049534 7:26652048-26652070 CTCTGTTCTCATCTGGCCTCTGG - Intergenic
1022325870 7:29331544-29331566 ATTCCGTTTCCTCTGGCTTCAGG - Intronic
1022646500 7:32234728-32234750 CTCCCTTCTCTTCTGTTTCCTGG - Intronic
1022877961 7:34554363-34554385 CTCCAATCTCTTCTGGCTTATGG - Intergenic
1023043597 7:36193481-36193503 CTCCCTCTGCCTCTGCCTTCAGG - Intronic
1023212313 7:37819949-37819971 CTCTCTTGCCTTCTGGCTTCTGG - Intronic
1023266779 7:38414737-38414759 CTCACTGCACCTCTGCCTTCTGG + Intronic
1023649322 7:42352017-42352039 TTCCCCTGCCCTCTGGCTTCTGG + Intergenic
1023983996 7:45084898-45084920 CGCTCTCCTCCTCTGTCTTCTGG + Exonic
1024007016 7:45232060-45232082 CCCCCATCTCATCTGGCTCCTGG + Intergenic
1024984449 7:55183069-55183091 CTTCCTGCCTCTCTGGCTTCTGG + Intronic
1026915327 7:74116603-74116625 CTGCCCCCTCCTCTGTCTTCAGG + Intronic
1027197870 7:76043519-76043541 CTCCCTCAGCCCCTGGCTTCTGG - Intronic
1027235345 7:76294621-76294643 CTCCCTGGACCTCTGGTTTCTGG - Intergenic
1027253050 7:76411101-76411123 CTCCCTCCTCCCCTGGCCTGGGG + Intronic
1027583622 7:80028696-80028718 TTCTCTTGACCTCTGGCTTCTGG - Intergenic
1028146797 7:87328428-87328450 CTCCTGTCTCCTCTGGGTCCTGG + Intergenic
1028645852 7:93095941-93095963 CTCCCTTGTCCTCTAGTTTCTGG + Intergenic
1028675736 7:93458535-93458557 CTGCCTTGCCCTCTGGTTTCTGG + Intronic
1028819237 7:95187043-95187065 TTCCCTTCTTCTCTGTCTTTTGG + Intronic
1029442897 7:100597227-100597249 CTTCCTTCTCATGTGGCTTCTGG - Intronic
1029857259 7:103529911-103529933 ATCTCCTCTCATCTGGCTTCTGG + Intronic
1030600285 7:111584332-111584354 CCCTCTCCTCCTCTGGCATCAGG - Intergenic
1031001613 7:116421918-116421940 CTCACTGCACCTCTGGCTCCCGG - Intronic
1031973291 7:128078765-128078787 CACCCTGCTCCTTTGGCTTGGGG - Intronic
1031978448 7:128108251-128108273 CTCCCTCCATCTCTGGCTTCTGG - Intergenic
1032281730 7:130508653-130508675 CTCCCTTCTCCTCCAGTTGCAGG - Exonic
1032909523 7:136413461-136413483 CCCCCTGCTCCCATGGCTTCAGG + Intergenic
1032921727 7:136556696-136556718 ATCCCTAGTCCTGTGGCTTCTGG + Intergenic
1033331135 7:140417775-140417797 CCCTCGCCTCCTCTGGCTTCTGG + Intronic
1034136233 7:148772896-148772918 CTGTCTCCTCCTCTGTCTTCTGG + Intronic
1034153058 7:148931961-148931983 CTCCCTATCCATCTGGCTTCAGG + Intergenic
1034477079 7:151291465-151291487 CTCTCTTATCTTCTGGCTTCTGG - Intergenic
1035168874 7:157006963-157006985 CTCAGTTCTCCTCTTGCCTCTGG - Intronic
1035189226 7:157151172-157151194 CTCCCTTCTACGGTGGCTTCAGG - Intronic
1035260527 7:157659035-157659057 CTCCCTTCACCCCGGGCTGCCGG + Intronic
1035844056 8:2844083-2844105 ATCCCGTGTCCTCTGGATTCCGG + Intergenic
1035871392 8:3139403-3139425 CGCCCTTTTCCCTTGGCTTCAGG - Intronic
1036600898 8:10259513-10259535 CTCCCTGCTCCTGTGGCTGGGGG + Intronic
1036772960 8:11591713-11591735 CTCTCATCTCCTCTGGCCCCAGG - Intergenic
1037481947 8:19313744-19313766 CTCCCTTCCCCGACGGCTTCTGG + Exonic
1037507925 8:19551022-19551044 CACCCTTCACATCTGTCTTCTGG + Intronic
1037928899 8:22865698-22865720 CTCCCCTTTCCTCTGGGATCCGG - Intronic
1038337262 8:26655593-26655615 CTCTCTTCTCCTCTCCCTCCAGG + Exonic
1038370811 8:26988415-26988437 ATCACTTTTCCTCAGGCTTCTGG + Intergenic
1039456225 8:37709042-37709064 CCTCCTTCTCCTCTGGCACCAGG - Intergenic
1039472862 8:37825008-37825030 CTCCCTCCACATCTGGCTTAGGG + Intronic
1039485862 8:37909302-37909324 CACTCGTGTCCTCTGGCTTCTGG - Intergenic
1039761636 8:40583119-40583141 ATCCCTTCTCCACAGGCTTAAGG - Intronic
1040516087 8:48136360-48136382 CTCCCTTTCCTTCTGGCTTCTGG + Intergenic
1041126298 8:54643720-54643742 CTCACCTCTTCTCTGGCTTTTGG + Intergenic
1041196949 8:55410264-55410286 CTCCCTTCTCCACTGATTTCCGG + Intronic
1041214431 8:55585753-55585775 CCCACCTCTCCCCTGGCTTCTGG + Intergenic
1041435784 8:57840125-57840147 TTTCCTTCTCCTCTGCTTTCTGG + Intergenic
1041761933 8:61376583-61376605 CTCCTTTCTGCTCTGGCTGCAGG + Exonic
1041773624 8:61499482-61499504 CTCCCTTCTCCTCATGTTTCAGG - Exonic
1041802971 8:61819940-61819962 TTTCCTTCTCCACTGTCTTCAGG + Intergenic
1043187914 8:77178533-77178555 CTCCCTTGCATTCTGGCTTCTGG + Intergenic
1044607194 8:94057716-94057738 CTCCCTTGTGCTCTGGCTTCTGG - Intergenic
1044648477 8:94469382-94469404 CTTGCTTCTCCTTTGCCTTCCGG + Intronic
1044729781 8:95220524-95220546 CTCCCTGCTCCTCCTGCTCCTGG + Intergenic
1045037153 8:98184643-98184665 CACCTTTCTCCTTTGGCTTGGGG - Intergenic
1045193706 8:99908610-99908632 TTCCCTTCTCACCTGCCTTCTGG - Intergenic
1045364255 8:101461073-101461095 CTCCCTTCTCCTAGGGATTAGGG - Intergenic
1045955232 8:107898194-107898216 CTCCCTTGCCTACTGGCTTCTGG + Intergenic
1046112457 8:109741818-109741840 CTCACCTCTCCTCTGGCCACTGG + Intergenic
1046432750 8:114150773-114150795 CTCCCATCTCCTTGGGCTGCCGG - Intergenic
1046794261 8:118353804-118353826 ATCCCTTGCCCTCTAGCTTCTGG + Intronic
1047036594 8:120946217-120946239 CTCCTTTCTCATCTGGATGCTGG + Intergenic
1047362778 8:124184316-124184338 CTGCTTTGCCCTCTGGCTTCGGG + Intergenic
1047775314 8:128065570-128065592 CTCCCTTACCCTCAGGGTTCAGG - Intergenic
1048209942 8:132446465-132446487 CTCCCTCCTTCCCTGGGTTCAGG + Intronic
1048240004 8:132731950-132731972 CTCCCAATTCCTCTGGCTTGGGG - Intronic
1048498513 8:134955650-134955672 CCCCCTGGTCCTCTGGCTTCTGG + Intergenic
1049019570 8:139946446-139946468 CTCCCTTGTCCTCTGGAGTCGGG + Intronic
1049164784 8:141119101-141119123 CCCCCTGCTCCCCTGGCCTCAGG - Intronic
1049409577 8:142466481-142466503 CTCCCTCCTCCTCGGGCCACTGG - Intronic
1049675828 8:143888601-143888623 CTCCCTGCTCCTTCAGCTTCTGG - Intergenic
1049683397 8:143929799-143929821 GGCGCTGCTCCTCTGGCTTCAGG + Exonic
1049958024 9:711352-711374 CTCCCTTCTTTTGTGGGTTCTGG + Exonic
1050428366 9:5535781-5535803 GTCCCTATTCCTCTGGATTCAGG + Intronic
1050569643 9:6924373-6924395 CCCCCTTTCCCTCTGGCTTCTGG + Intronic
1050947665 9:11546749-11546771 CTCCATTATCCTCTGGCCTTTGG - Intergenic
1051304699 9:15697072-15697094 CTCCTTTACCTTCTGGCTTCTGG + Intronic
1051448485 9:17167954-17167976 CTCCATTGTCCTCTTCCTTCTGG + Intronic
1051796781 9:20880485-20880507 CTCCCATGTCCTCTGGCTTCTGG - Intronic
1051881326 9:21842574-21842596 CTCCAATCCCTTCTGGCTTCTGG - Intronic
1052086689 9:24275900-24275922 CTCCCATGTACTCTGGCTTCTGG - Intergenic
1052988874 9:34506921-34506943 CTCCCTCCTCCAGTGGCTCCAGG - Intronic
1053281265 9:36820964-36820986 CCCCCTTGCCCTCTAGCTTCTGG - Intergenic
1053290453 9:36876202-36876224 CCCACCTCTCCTCTGGCCTCAGG + Intronic
1053671090 9:40362925-40362947 CTCCCTCATCCTCTGGCTTCAGG + Intergenic
1053832186 9:42095176-42095198 CCACCTTCTCCTCTAGCGTCTGG + Intronic
1053920898 9:42989305-42989327 CTCCCTCACCCTCTGGCTTCAGG + Intergenic
1054382206 9:64502989-64503011 CTCCCTCACCCTCTGGCTTCAGG + Intergenic
1054513524 9:66013375-66013397 CTCCCTCATCCTCTGGCTTCAGG - Intergenic
1055040852 9:71870140-71870162 CTTCATTCTCCTCTGACTTCGGG - Exonic
1055723297 9:79199671-79199693 TTCCCTTGACCTCTGGCTTCTGG - Intergenic
1056178771 9:84061508-84061530 CTCCCTTCACCTCTGTCATCAGG - Intergenic
1056453083 9:86735312-86735334 CCCCTTTGTTCTCTGGCTTCTGG - Intergenic
1056686135 9:88761829-88761851 TTCCCTACTCTTCTGTCTTCTGG - Intergenic
1057469904 9:95348329-95348351 CTCCCTGCACCTCTGCCTCCTGG - Intergenic
1057726207 9:97570316-97570338 CTACCCTCTTCTCTGCCTTCTGG + Intronic
1058095662 9:100857385-100857407 CTCCCTTCTCACGTGCCTTCAGG + Intergenic
1058110542 9:101027848-101027870 CTGCCATCTCCCCTGGCCTCAGG + Intergenic
1058489014 9:105475234-105475256 CTCCCTTCTACTCTGACAACCGG - Intronic
1059068336 9:111108515-111108537 TTCCCTTTGCCTCTGCCTTCCGG + Intergenic
1059372507 9:113854185-113854207 CTCCCCTGCCCTTTGGCTTCTGG + Intergenic
1059504056 9:114781915-114781937 TTCCCTTCTCCACTGGCCTCAGG - Intergenic
1059525389 9:114986638-114986660 CTCCTTTGTCCTCTGCCCTCTGG - Intergenic
1060077965 9:120611577-120611599 CTCCCTTTTCCTCTGGCCTTAGG - Intronic
1060225104 9:121785714-121785736 CCCCCTCCTCCTCTGGGTTGAGG + Intergenic
1060595327 9:124844382-124844404 CTCTCTTCTCTACTGGCTTCTGG - Intergenic
1060881348 9:127120407-127120429 CCCCCCTCTCCTCAGGCTCCTGG + Intronic
1061418743 9:130461984-130462006 CTGCCTCCGCCTCTGCCTTCAGG - Intronic
1061534377 9:131238641-131238663 CTGCCGTCTCCTCTGGGGTCTGG + Intergenic
1061571259 9:131478681-131478703 CTCCCTTACCCTCTGGCTCTGGG - Intronic
1061836763 9:133334509-133334531 CAGCCTTCTCTTCTCGCTTCCGG + Exonic
1061847692 9:133397077-133397099 CTCCCTCTGCCTCTGGCTCCGGG - Intronic
1061913667 9:133738144-133738166 CTCCCTCTGCCTCTGGCTGCAGG - Intronic
1062192088 9:135253334-135253356 CTCCCTTGTGCTGTGGGTTCGGG - Intergenic
1062202310 9:135309989-135310011 CCCCCTGCGCCTCTTGCTTCAGG - Intergenic
1062286983 9:135777738-135777760 CCCCCAGCTCCTCTGGCTCCTGG + Intronic
1062423329 9:136494410-136494432 CTCCCCTCTGCTCTGGCCTTTGG - Intergenic
1062688094 9:137826681-137826703 CTCCCCTCTCCTCTGGGCTGCGG - Intronic
1062713002 9:137986892-137986914 CTCCCGTCTCCCCTGGGTGCTGG + Intronic
1186217235 X:7313096-7313118 CTCCCTTTTTCTCTGCCTACAGG + Intronic
1186382985 X:9080615-9080637 CTCCCTTCTCCACTGACTGTTGG - Intronic
1187000253 X:15169337-15169359 CCCCCTATACCTCTGGCTTCTGG + Intergenic
1188604908 X:32016270-32016292 CTCCCTTTCCCTCCTGCTTCCGG + Intronic
1188715053 X:33449911-33449933 TTCCCTTCTTCTCTGCCTCCAGG + Intergenic
1189280261 X:39816175-39816197 CTGCCTTGACCACTGGCTTCTGG - Intergenic
1189589546 X:42496733-42496755 CTCCCTTGACTTCTGGCTTCTGG + Intergenic
1189674029 X:43442991-43443013 CTGCCTTTTCCTGTGGCTCCTGG - Intergenic
1189694636 X:43651995-43652017 CTCCCTTGTTTTCTAGCTTCTGG + Intergenic
1189744636 X:44157470-44157492 CTTCCTTGCTCTCTGGCTTCTGG + Intronic
1190246324 X:48692928-48692950 CTCCCTCCTTCTCTAGCTTGGGG - Intergenic
1190739530 X:53280159-53280181 CTCCCTACCCCTGTGGCGTCTGG - Intronic
1191640814 X:63428616-63428638 CTCCCCTCTCCTCTAACTGCTGG - Intergenic
1191683386 X:63864662-63864684 CTCCACTCTCTTCTGGCTTGTGG + Intergenic
1191692102 X:63950864-63950886 TTCCCTTGTTCTGTGGCTTCTGG + Intergenic
1192056643 X:67780464-67780486 TTCTCTTTTCCTCTGGCTCCAGG - Intergenic
1192247647 X:69386963-69386985 CTCCCCTCTCCACTGACTTTCGG - Intergenic
1192545502 X:72009370-72009392 CTCCCTTGCCCTCTGGCTTCGGG - Intergenic
1193446450 X:81610752-81610774 TTCCCTCCACCTCTAGCTTCTGG + Intergenic
1195364804 X:104115506-104115528 CTCTCTTCTCTGCTGGCTTAAGG + Exonic
1195974480 X:110511443-110511465 CTCCTTTGCCCTCTGGCATCTGG + Intergenic
1196315950 X:114223662-114223684 TTCCCTTCTCCTCTAGTTTTCGG - Intergenic
1196350584 X:114724843-114724865 CCCCATTCTCTTCTGGCTTGTGG + Intronic
1196370492 X:114973791-114973813 TTCCCTTCTCTTCTGGCCTGTGG - Intergenic
1198269916 X:135047134-135047156 TTCCCTTGCTCTCTGGCTTCTGG + Intergenic
1198872400 X:141189307-141189329 TTCCCTTCTCCTCTGTCATTTGG + Intergenic
1199774463 X:150998648-150998670 CACCCCTCACCCCTGGCTTCTGG + Intergenic