ID: 1136184002

View in Genome Browser
Species Human (GRCh38)
Location 16:28574408-28574430
Sequence TTCTGGTGATGTGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136183998_1136184002 -1 Left 1136183998 16:28574386-28574408 CCATCTGAGGCTTTCTTCACTGT 0: 1
1: 2
2: 77
3: 152
4: 359
Right 1136184002 16:28574408-28574430 TTCTGGTGATGTGCCCTGGGAGG 0: 1
1: 0
2: 3
3: 12
4: 175
1136183997_1136184002 0 Left 1136183997 16:28574385-28574407 CCCATCTGAGGCTTTCTTCACTG 0: 1
1: 2
2: 68
3: 139
4: 312
Right 1136184002 16:28574408-28574430 TTCTGGTGATGTGCCCTGGGAGG 0: 1
1: 0
2: 3
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136184002 Original CRISPR TTCTGGTGATGTGCCCTGGG AGG Intronic
900405447 1:2490945-2490967 TTCTGGCCCTGTGGCCTGGGAGG - Intronic
901507411 1:9693940-9693962 ATCTGGCTATGTGGCCTGGGGGG - Intronic
902210581 1:14901695-14901717 TTTTGGGGATGTGACCTGGATGG - Intronic
902213537 1:14920741-14920763 TTCTGGGCATGTGACCTGTGTGG - Intronic
904435109 1:30489943-30489965 TCCTGGCTATGTGCCCTAGGAGG - Intergenic
905689016 1:39929032-39929054 TCCTGGTGATGTGTCTGGGGAGG + Intergenic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
907017844 1:51034596-51034618 TTCTGCTGTTGTGCCCTGGAAGG + Intergenic
907317634 1:53582585-53582607 CTCTTGTCATGTGCACTGGGAGG - Intronic
907624000 1:56010707-56010729 ATCTGGTGATGTGCAGTTGGGGG - Intergenic
912415645 1:109506810-109506832 TTTTCCTGATGTGCCCTGGGTGG - Exonic
914979212 1:152398141-152398163 TTTTGGAGAGGTGTCCTGGGTGG - Intergenic
917149372 1:171928526-171928548 GTCTGGTGATGAGCACTGGAGGG + Intronic
919954704 1:202401998-202402020 TGCTAGTGAAGTGCTCTGGGAGG + Intronic
921108452 1:212008626-212008648 TTCTGGTCATCTGCACTAGGAGG + Intronic
1063002379 10:1936399-1936421 TGCTGGAGTTCTGCCCTGGGGGG - Intergenic
1064529598 10:16294491-16294513 TTCTGGTGATTAGACTTGGGTGG + Intergenic
1067562995 10:47316989-47317011 TTTTAGTGATGTCTCCTGGGAGG + Intergenic
1071333692 10:84585081-84585103 ATCTGGTGAAGGCCCCTGGGAGG + Intergenic
1072608979 10:97004277-97004299 TTCTGGGGAAGTGCCCAGGCAGG - Intronic
1074227941 10:111505730-111505752 TTCTGGTGGAGTGTCCTGGAAGG + Intergenic
1075574931 10:123571252-123571274 TTCTGGGGAGGTGCACTGAGCGG + Intergenic
1076478013 10:130766179-130766201 TTCCAGTGAGGTGCCCTGGTCGG + Intergenic
1076607104 10:131696136-131696158 TTCCGGTGCTTTGCTCTGGGAGG - Intergenic
1077534078 11:3110881-3110903 TCCTGACGATGTGCCCAGGGTGG - Intronic
1077823677 11:5779904-5779926 ATATGTTGATGTGACCTGGGTGG - Intronic
1078339552 11:10489028-10489050 TTCAGCTCATGTGCCCTGAGAGG + Intronic
1079668513 11:23136215-23136237 TTCTTGTGAGGTGCCGTGGGAGG + Intergenic
1080900000 11:36480693-36480715 TTCAGGTTAAGTGACCTGGGGGG + Intergenic
1083662982 11:64260411-64260433 TGCTGGTGATGTGGCCTGGGAGG + Intronic
1085471066 11:76758404-76758426 GTCTGTTGATGGGCACTGGGTGG + Intergenic
1086339971 11:85838718-85838740 TGCTGGAGATGAGCCCTGGTGGG - Intergenic
1086370746 11:86153104-86153126 TTTTGGAAATGTTCCCTGGGTGG + Intergenic
1087226614 11:95607981-95608003 TTCTGGTGCTGTGGGCTGCGTGG + Intergenic
1087529827 11:99365911-99365933 TTCTGGTGATGTGTTATGGATGG + Intronic
1088997407 11:115013432-115013454 TTCTGCTGGTGTGCCCTGCTGGG - Intergenic
1089108752 11:116037249-116037271 TTCTCGTGGTGGGCCCTGAGTGG - Intergenic
1089195664 11:116692832-116692854 TTCAGCTGCTGTGCCCTGAGAGG - Intergenic
1089219425 11:116858505-116858527 GGCTGCTGATGTGCACTGGGAGG + Exonic
1090401535 11:126452593-126452615 TCCTGGTGAGGGGCCCTGGAAGG - Intronic
1090978779 11:131698248-131698270 TTCTGTTCCTGTGCCCTAGGTGG - Intronic
1095201279 12:39387374-39387396 TTCTGGTTATGTCCTTTGGGAGG - Intronic
1096131187 12:49160195-49160217 TTCTGGTGGAATGCCCTGGAAGG + Intergenic
1096605355 12:52761053-52761075 TGCTGGTTTTGTGGCCTGGGGGG - Intergenic
1097301756 12:58026581-58026603 ATCTGTTGATTTGCTCTGGGAGG + Intergenic
1098922808 12:76318321-76318343 ATCTGGTGATGAGCCTTTGGAGG + Intergenic
1101641659 12:106589636-106589658 TCTAGGTGATGTGGCCTGGGTGG - Intronic
1105783923 13:23729029-23729051 CTCTGGTGCAGTGCCCAGGGAGG - Intergenic
1105821334 13:24083667-24083689 TTCTTCTGATTTGCCCTGAGAGG + Intronic
1110187104 13:72688209-72688231 TTCTGGTGATCTGTCATGAGAGG + Intergenic
1114550899 14:23532319-23532341 TTCTGGTGTTTGGCCCTGGAGGG - Intronic
1114582524 14:23775505-23775527 TTGTAGTGATGTGCCCCAGGGGG + Intergenic
1114823451 14:26049696-26049718 TACTGGTCATGTTCCCTGAGTGG + Intergenic
1120140569 14:80926016-80926038 TTCAGGTGAGGTCCCCTGTGAGG - Intronic
1120733025 14:88023776-88023798 TTCTTCCGTTGTGCCCTGGGAGG - Intergenic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1122953601 14:105059720-105059742 TCCTGATGACGTGCCCAGGGTGG - Intronic
1202836295 14_GL000009v2_random:79680-79702 CTCTGGTGATGAGCAGTGGGGGG - Intergenic
1124261110 15:28192370-28192392 ATCTGCTGTTGTTCCCTGGGAGG - Intronic
1130199537 15:81812102-81812124 TTCTGGAGGTCTGCACTGGGAGG - Intergenic
1132424141 15:101699737-101699759 TTCTTGTGCTGTGCCCCTGGAGG - Intronic
1134748293 16:16605025-16605047 GTGTGGGGATGTGACCTGGGAGG - Intergenic
1134997170 16:18748590-18748612 GTGTGGGGATGTGACCTGGGAGG + Intergenic
1136184002 16:28574408-28574430 TTCTGGTGATGTGCCCTGGGAGG + Intronic
1137742715 16:50795960-50795982 TTATGGTGAAGTGTGCTGGGTGG + Intronic
1138201036 16:55088586-55088608 ATCTTGTGGTGTGCCCAGGGAGG + Intergenic
1139000643 16:62506107-62506129 TGGGGGTCATGTGCCCTGGGAGG + Intergenic
1139395480 16:66635430-66635452 CTCTCCTGGTGTGCCCTGGGTGG - Intronic
1147462284 17:40580934-40580956 TTGGGGTGATGTGGCCTGTGGGG + Intergenic
1148952141 17:51322598-51322620 TTCTAGAGATGTGCTCTAGGAGG + Intergenic
1148983592 17:51600674-51600696 TGCTGGTGATGGGGCCTGGTGGG + Intergenic
1149054687 17:52349360-52349382 TTCTGATGATGTGACCTGATAGG - Intergenic
1150433054 17:65133852-65133874 TTCTTGTGCTGTTCCCTGTGAGG + Intergenic
1150915833 17:69435899-69435921 TTCGGGTGATCTGCCCTCTGTGG + Intronic
1151215263 17:72572711-72572733 TTCTTCAGATGTGCTCTGGGAGG + Intergenic
1152005885 17:77680912-77680934 TTCTGCTGCTGTGTCCTGTGAGG - Intergenic
1152395806 17:80032305-80032327 TTCTGTTGCTGAGCCTTGGGCGG - Intronic
1154494815 18:14947869-14947891 TTCTGGAGATGGGCCCTTTGTGG + Intergenic
1155593238 18:27452544-27452566 TACTGGTGGTGTTCTCTGGGAGG + Intergenic
1156364144 18:36409750-36409772 CTCTGGGGGTGTGGCCTGGGTGG + Intronic
1158072858 18:53494296-53494318 TTCTGTTGATGTGGGCTGGAGGG + Intronic
1158407428 18:57172610-57172632 TTCTGGGGATGAGATCTGGGTGG + Intergenic
1159190136 18:65030340-65030362 TTCTGGTGATCTGCCCTTCTCGG + Intergenic
1159528474 18:69625359-69625381 CTCTGGTGATGCACCTTGGGAGG + Intronic
1161295275 19:3516581-3516603 TCCAGGTGAGGTGCCCCGGGAGG + Intronic
1161553173 19:4925753-4925775 TTCAGGTGATCTGCCCTCGTTGG + Intronic
1162365340 19:10245341-10245363 TTCTGGTGAGGAGGCCAGGGCGG + Intergenic
1162828170 19:13267194-13267216 TCCTGGTGATGTGGCATCGGAGG + Intronic
1162931470 19:13959888-13959910 TTCTGGAGGTGGGCCCAGGGCGG + Exonic
1166194552 19:41197383-41197405 TTCTAGTGAGGTTCCCTGAGGGG - Intronic
1167245302 19:48369480-48369502 TTCTTGTGATTTGCCCAGAGAGG - Intronic
1202636344 1_KI270706v1_random:47685-47707 CTCTGGTGATGAGCAGTGGGGGG + Intergenic
925142413 2:1559254-1559276 TGCTGGTGAGGGGCCCTGTGTGG - Intergenic
927132668 2:20073628-20073650 TTTTGGCGAGGTGTCCTGGGGGG + Intergenic
929673752 2:43903552-43903574 TTGTGGTGATGTGCTCAGGGAGG + Intronic
931219464 2:60276293-60276315 TGCTGCTGCTGAGCCCTGGGTGG - Intergenic
935179056 2:100674182-100674204 GTTTGGAGATGTTCCCTGGGAGG - Intergenic
942422783 2:175825221-175825243 TTCTGGTGAGGTGCTCTCTGTGG + Intergenic
944498177 2:200329597-200329619 CTCTGGTGTTGAGCCCTGAGAGG - Intronic
946924379 2:224612168-224612190 TTGTGGAAATGTGCCCTGGGGGG + Intergenic
948529503 2:238595356-238595378 TTCTGGTGAAGGGCCCTATGGGG + Intergenic
1170073083 20:12390032-12390054 TTCTGGTTTCGTGCGCTGGGAGG - Intergenic
1170074866 20:12408683-12408705 GTCTGGTAAAGAGCCCTGGGAGG - Intergenic
1170456540 20:16538770-16538792 TGCTGGTGGTGTGGCCTGGTGGG + Intronic
1170702263 20:18714008-18714030 TCCTGGAGATGTGACCTGGAAGG + Intronic
1171074011 20:22103977-22103999 TTCTGGTCATCTGCCCTATGGGG + Intergenic
1172225282 20:33301443-33301465 TTCCTATGATGTGGCCTGGGCGG - Intronic
1173970176 20:47146544-47146566 TTCTGCTGAGGTGCCCTGGGGGG - Intronic
1175827129 20:61942386-61942408 TGCTGGTTCTGTGTCCTGGGAGG - Intergenic
1178765810 21:35450155-35450177 TGCTGGTGATGGGGCCTGGTGGG - Intronic
1180364521 22:11926631-11926653 CTCTGGTGATGAGCAGTGGGGGG - Intergenic
1180758118 22:18177466-18177488 TTCTGTTGTGGGGCCCTGGGAGG + Intergenic
1180768407 22:18361258-18361280 TTCTGTTGTGGGGCCCTGGGAGG + Intergenic
1180777903 22:18501133-18501155 TTCTGTTGTGGGGCCCTGGGAGG - Intergenic
1180810627 22:18758444-18758466 TTCTGTTGTGGGGCCCTGGGAGG - Intergenic
1180826284 22:18864482-18864504 TTCTGTTGTGGGGCCCTGGGAGG + Intergenic
1181196775 22:21192699-21192721 TTCTGTTGTGGGGCCCTGGGAGG - Intergenic
1181212753 22:21300425-21300447 TTCTGTTGTGGGGCCCTGGGAGG + Intergenic
1203230025 22_KI270731v1_random:102146-102168 TTCTGTTGTGGGGCCCTGGGAGG + Intergenic
1203276425 22_KI270734v1_random:90388-90410 TTCTGTTGTGGGGCCCTGGGAGG + Intergenic
950244558 3:11404367-11404389 TTCAAGTGATCTGCCCTGGTTGG + Intronic
951197085 3:19836346-19836368 GTCTGGTGATAAGCCATGGGGGG - Intergenic
953760114 3:45679983-45680005 TTCTGCTGTTGAGTCCTGGGTGG + Exonic
953788094 3:45925925-45925947 TTGTGTTGTTGTGTCCTGGGAGG - Intronic
954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG + Intergenic
959281828 3:104351987-104352009 TTCTGATGATATGCCCCAGGTGG - Intergenic
960988047 3:123293081-123293103 TTCTGGGGCTGCGCCCTGGCAGG + Intronic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
961642622 3:128374142-128374164 TTCAGGTGCTGGACCCTGGGTGG - Intronic
961669391 3:128517938-128517960 TGCTGATCATGTTCCCTGGGAGG - Intergenic
963771833 3:149394653-149394675 TTCTGGGGATGAGAACTGGGTGG + Intergenic
964750819 3:160052267-160052289 TTCTGGTGCTGTGCCATGCTTGG + Intergenic
965958991 3:174406348-174406370 TTCTGGTGAGATTCCCTGGTTGG + Intergenic
966066158 3:175824728-175824750 TTCTGGTCATGTTCCTTTGGAGG - Intergenic
966511335 3:180766545-180766567 TTGTTGTGGTCTGCCCTGGGTGG - Intronic
974630518 4:64481582-64481604 TTCCAGTGGTGTGCCCTGGAAGG - Intergenic
977398279 4:96498925-96498947 TTCTGCTGATGTGCTGTTGGAGG - Intergenic
978555013 4:109970568-109970590 ATCTGTTGATGTGCTTTGGGAGG + Intronic
980265323 4:130507513-130507535 TTCTGGTATTGTGACTTGGGTGG + Intergenic
983497034 4:168454091-168454113 TGCTGAAGATGTGCCGTGGGTGG - Intronic
984579600 4:181496033-181496055 TTCTGGTCATTTGCTCTGGCAGG - Intergenic
1202763661 4_GL000008v2_random:133552-133574 CTCTGGTGATGAGCAGTGGGGGG + Intergenic
990182375 5:53175145-53175167 TGCTGGTGATGTGATCTTGGAGG + Intergenic
991002359 5:61795132-61795154 TTCTGGTCAGGTGCACTGGAAGG - Intergenic
993449817 5:88059738-88059760 TACTGGTTGTGTACCCTGGGTGG + Intergenic
994365934 5:98917209-98917231 TCCTGGTGATGTGACTTTGGTGG - Intronic
997315600 5:132932192-132932214 TTCTGGTGATGTGAGCTGTGTGG - Exonic
1001761374 5:174210855-174210877 TTCTGGTGAGGTTTCCTGGCAGG - Intronic
1004406742 6:15339766-15339788 CTCAGGTGATGTGCCCTCGTCGG + Intronic
1005324262 6:24683573-24683595 TTCTGATGACGTGCCCAAGGTGG + Intronic
1009514396 6:64596196-64596218 TGCTGGAGATGTGGCCTGGGGGG - Intronic
1014152272 6:118071596-118071618 TTCTGGTGATGTGCTCTAGGGGG - Intronic
1015154783 6:130080548-130080570 TCCTGGTTATGTACCCTGGAAGG + Intronic
1019155725 6:170037679-170037701 TGCTGGTTCTGGGCCCTGGGAGG - Intergenic
1020042282 7:5013088-5013110 TTGTGATGAGATGCCCTGGGAGG + Intronic
1020247810 7:6443691-6443713 TGGTGGTGAGGTGCACTGGGAGG - Intronic
1021897550 7:25251231-25251253 ATCTGATGATGTCCACTGGGTGG + Intergenic
1024674459 7:51625639-51625661 TTCTGGTCTTGTGCCTAGGGAGG + Intergenic
1025247882 7:57331153-57331175 TTGTGGTGAGGTGGCCAGGGAGG - Intergenic
1026005110 7:66594169-66594191 TTCTGGTTTTCCGCCCTGGGTGG - Intergenic
1031627094 7:124004330-124004352 GTCTGGTGATGAGCCATGGGTGG + Intergenic
1031765326 7:125770631-125770653 TTCCAGTGATGTGCCCTAGTAGG + Intergenic
1035177225 7:157060093-157060115 TTCTGGTGTGGTGTCCGGGGAGG + Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035578387 8:724095-724117 TTCTGGTGATGTCCCATTTGAGG - Intronic
1035888829 8:3322730-3322752 TACTCGTGATATGCCCTGGATGG - Intronic
1036560889 8:9899463-9899485 TTCGCGTGATGTTCCCAGGGCGG - Intergenic
1037438653 8:18891620-18891642 TTCTGGGGAAGTGCTCTCGGAGG - Intronic
1041292709 8:56321698-56321720 TTCTGGTCAGAAGCCCTGGGTGG + Intergenic
1041561837 8:59226743-59226765 TTCTGGTGATGAGCAGTGGAGGG - Intergenic
1044162488 8:88936301-88936323 GTCTGGTGATGTGCCATGCTGGG - Intergenic
1046342706 8:112879587-112879609 TGCTGGTTTTGTGGCCTGGGGGG + Intronic
1049244891 8:141557194-141557216 TTCTGGTGATGTGAACTGCCTGG + Intergenic
1049452928 8:142672039-142672061 TTCTGGGGAGGGGCCCTGGCAGG - Intronic
1050684136 9:8147835-8147857 TTCTGGAGATGGGCCCTGACTGG + Intergenic
1055882598 9:81019534-81019556 TTCTGATGATGTTCCCAGGGAGG + Intergenic
1056935180 9:90910984-90911006 TTCTGGTGGTGGGGACTGGGCGG - Intergenic
1056964910 9:91157441-91157463 TTCAGGTGATCTGCCCTGATCGG - Intergenic
1060835344 9:126751483-126751505 TTCTGGAGCTCTGCACTGGGCGG + Intergenic
1061883972 9:133582414-133582436 TACTGGTGCTGGGGCCTGGGCGG - Intronic
1062261958 9:135667295-135667317 TGCTGGGGGTGTGCGCTGGGCGG + Intergenic
1203544414 Un_KI270743v1:118425-118447 CTCTGGTGATGAGCAGTGGGGGG + Intergenic
1186225590 X:7395882-7395904 TTCTTGCTTTGTGCCCTGGGAGG + Intergenic
1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG + Intergenic
1192891936 X:75399439-75399461 GTCTGGTGATGAGCCATGGGTGG - Intronic
1193644134 X:84046671-84046693 TTCAGGTGATGGGTGCTGGGCGG + Intergenic
1193739636 X:85202736-85202758 TTCTGGTGATGAGCCATGGAGGG + Intergenic
1195634514 X:107098765-107098787 TTCTGGTGATCTGCCCTCCTTGG - Intronic
1200308136 X:155049330-155049352 TGGTGGTGAAGTCCCCTGGGTGG - Intronic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic