ID: 1136192972

View in Genome Browser
Species Human (GRCh38)
Location 16:28629403-28629425
Sequence GCGGAGTGAAACACTTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136192969_1136192972 11 Left 1136192969 16:28629369-28629391 CCTCACAACTCTTTATAGTCTTG No data
Right 1136192972 16:28629403-28629425 GCGGAGTGAAACACTTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136192972 Original CRISPR GCGGAGTGAAACACTTTAAA TGG Intergenic
No off target data available for this crispr