ID: 1136199707

View in Genome Browser
Species Human (GRCh38)
Location 16:28679624-28679646
Sequence GTGGATGGAGAGGCACGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136199707_1136199720 29 Left 1136199707 16:28679624-28679646 CCCACTCGTGCCTCTCCATCCAC No data
Right 1136199720 16:28679676-28679698 CAGCCTTGGCCAGCCCAGAAAGG 0: 229
1: 528
2: 627
3: 366
4: 470
1136199707_1136199712 -4 Left 1136199707 16:28679624-28679646 CCCACTCGTGCCTCTCCATCCAC No data
Right 1136199712 16:28679643-28679665 CCACACCTCCCCGCAAGCTAAGG 0: 7
1: 232
2: 1077
3: 709
4: 401
1136199707_1136199718 15 Left 1136199707 16:28679624-28679646 CCCACTCGTGCCTCTCCATCCAC No data
Right 1136199718 16:28679662-28679684 AAGGCAGCTGGCTCCAGCCTTGG No data
1136199707_1136199714 3 Left 1136199707 16:28679624-28679646 CCCACTCGTGCCTCTCCATCCAC No data
Right 1136199714 16:28679650-28679672 TCCCCGCAAGCTAAGGCAGCTGG No data
1136199707_1136199721 30 Left 1136199707 16:28679624-28679646 CCCACTCGTGCCTCTCCATCCAC No data
Right 1136199721 16:28679677-28679699 AGCCTTGGCCAGCCCAGAAAGGG 0: 250
1: 794
2: 496
3: 377
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136199707 Original CRISPR GTGGATGGAGAGGCACGAGT GGG (reversed) Intergenic
No off target data available for this crispr