ID: 1136200176

View in Genome Browser
Species Human (GRCh38)
Location 16:28683326-28683348
Sequence CAATTTATGGAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136200165_1136200176 21 Left 1136200165 16:28683282-28683304 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG No data
1136200168_1136200176 0 Left 1136200168 16:28683303-28683325 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG No data
1136200170_1136200176 -2 Left 1136200170 16:28683305-28683327 CCAGCAGGATATGTTTTGGTCCA No data
Right 1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG No data
1136200169_1136200176 -1 Left 1136200169 16:28683304-28683326 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136200176 Original CRISPR CAATTTATGGAGGAGGAGGA AGG Intergenic
No off target data available for this crispr