ID: 1136214300

View in Genome Browser
Species Human (GRCh38)
Location 16:28781187-28781209
Sequence CTGTGGAAAGTGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136214294_1136214300 5 Left 1136214294 16:28781159-28781181 CCAGCCTCGGCTCGGCATCAGAG 0: 67
1: 556
2: 574
3: 370
4: 216
Right 1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG No data
1136214291_1136214300 26 Left 1136214291 16:28781138-28781160 CCGAGATGGTGGCAGTACAGTCC 0: 22
1: 170
2: 905
3: 703
4: 7990
Right 1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG No data
1136214297_1136214300 1 Left 1136214297 16:28781163-28781185 CCTCGGCTCGGCATCAGAGGGAG 0: 65
1: 133
2: 87
3: 16
4: 214
Right 1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136214300 Original CRISPR CTGTGGAAAGTGAGAGAGGA AGG Intergenic
No off target data available for this crispr