ID: 1136216513

View in Genome Browser
Species Human (GRCh38)
Location 16:28797475-28797497
Sequence GGACCAAAACATATCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136216513_1136216520 11 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216520 16:28797509-28797531 TGTTTTGGTCCAATTTATGGAGG No data
1136216513_1136216524 21 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG No data
1136216513_1136216515 -4 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216515 16:28797494-28797516 GTCCCCAGCAGGATATGTTTTGG No data
1136216513_1136216525 24 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216525 16:28797522-28797544 TTTATGGAGGAGGAGGAAGGAGG No data
1136216513_1136216519 8 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216519 16:28797506-28797528 ATATGTTTTGGTCCAATTTATGG No data
1136216513_1136216521 14 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216521 16:28797512-28797534 TTTGGTCCAATTTATGGAGGAGG No data
1136216513_1136216522 17 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216522 16:28797515-28797537 GGTCCAATTTATGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136216513 Original CRISPR GGACCAAAACATATCTGCAC TGG (reversed) Intergenic
No off target data available for this crispr