ID: 1136216516

View in Genome Browser
Species Human (GRCh38)
Location 16:28797496-28797518
Sequence GACCAAAACATATCCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136216516_1136216527 15 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216527 16:28797534-28797556 GAGGAAGGAGGAGAGTGAGGAGG No data
1136216516_1136216529 21 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216529 16:28797540-28797562 GGAGGAGAGTGAGGAGGAGGCGG No data
1136216516_1136216520 -10 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216520 16:28797509-28797531 TGTTTTGGTCCAATTTATGGAGG No data
1136216516_1136216528 18 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216528 16:28797537-28797559 GAAGGAGGAGAGTGAGGAGGAGG No data
1136216516_1136216522 -4 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216522 16:28797515-28797537 GGTCCAATTTATGGAGGAGGAGG No data
1136216516_1136216530 27 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216530 16:28797546-28797568 GAGTGAGGAGGAGGCGGAGAAGG No data
1136216516_1136216524 0 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG No data
1136216516_1136216526 12 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216526 16:28797531-28797553 GAGGAGGAAGGAGGAGAGTGAGG No data
1136216516_1136216521 -7 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216521 16:28797512-28797534 TTTGGTCCAATTTATGGAGGAGG No data
1136216516_1136216525 3 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216525 16:28797522-28797544 TTTATGGAGGAGGAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136216516 Original CRISPR GACCAAAACATATCCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr