ID: 1136216517

View in Genome Browser
Species Human (GRCh38)
Location 16:28797497-28797519
Sequence GGACCAAAACATATCCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136216517_1136216521 -8 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216521 16:28797512-28797534 TTTGGTCCAATTTATGGAGGAGG No data
1136216517_1136216524 -1 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG No data
1136216517_1136216522 -5 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216522 16:28797515-28797537 GGTCCAATTTATGGAGGAGGAGG No data
1136216517_1136216530 26 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216530 16:28797546-28797568 GAGTGAGGAGGAGGCGGAGAAGG No data
1136216517_1136216529 20 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216529 16:28797540-28797562 GGAGGAGAGTGAGGAGGAGGCGG No data
1136216517_1136216525 2 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216525 16:28797522-28797544 TTTATGGAGGAGGAGGAAGGAGG No data
1136216517_1136216528 17 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216528 16:28797537-28797559 GAAGGAGGAGAGTGAGGAGGAGG No data
1136216517_1136216526 11 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216526 16:28797531-28797553 GAGGAGGAAGGAGGAGAGTGAGG No data
1136216517_1136216527 14 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216527 16:28797534-28797556 GAGGAAGGAGGAGAGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136216517 Original CRISPR GGACCAAAACATATCCTGCT GGG (reversed) Intergenic
No off target data available for this crispr